McAfee SECURE sites help keep you safe from identity theft, credit card fraud, spyware, spam, viruses and online scams

Autoimmune Haemolytic Anaemia


Note: The essay examples we publish on UK Essays have been submitted to us by students. The essays are the student's work and are not examples of our expert essay writers' work. We never publish the work produced by our expert writers as their work is unique to the customer that ordered it.

Thank you to all the students that have submitted essays to us. Please use the essay below to inspire and help you with your own studies, but please ensure you reference the essay if you quote it in your own work.


UK Essays Custom Essay

Autoimmune Haemolytic Anaemia

Introduction

When the response of the human body's immune system is not apt it produces auto-antibodies which attack its own organs, tissues and cells. This inapt response leads to autoimmune diseases. These diseases can be treated by therapeutic proteins. So to choose a autoimmune disease and produce a therapeutic protein to treat is the topic of this coursework.

Disease – Autoimmune Haemolytic Anaemia - This is a type of anaemia which is caused when the red blood cells are attacked by the auto antibodies produced by the inapt human immune system. It lowers the amount of haemoglobin in the blood and reduces the oxygen transfer rate to the tissues. It is an auto immune condition.

This makes the patient very weak and tired and will not be able to perform normal daily functions. In severe conditions it is even difficult for the patient to move. Pregnant women and cancer patients are mainly affected by anaemia.

Protein to treat the disease – Recombinant Human Erythropoietin – Advent of this recombinant protein has become a possible alternative for blood cell fusion to treat the autoimmune condition. This recombinant erythropoietin is released into the plasma in order to bind to the erythropoietin receptors on the surface of the available red blood cell precursors that are present in the bone marrow. This induces their proliferation and differentiation resulting in the cells to multiply.

Strategy to produce Recombinant human erythropoietin using expression system

Pichia pastoris has become popular as an efficient alternative to S. cerevisiae, which is the most commonly used and studied yeast for production of heterologous proteins. There are several reasons that account for the popularity of the P. pastoris expression system: its ability to produce foreign proteins at high levels, either extracellularly or intracellularly; its facility in performing many post-translational modifications (e.g. glycosylation without the hyperglycosylation of S. cerevisiae, correct disulfide bond formation and proteolytic processing); the availability of the alcohol oxidase I (AOX1) promoter (known to be one of the strongest and most tightly regulated eukaryotic promoters) for controlled gene expression; the ability to stably integrate expression plasmids at specific sites in the P. pastoris genome in either single or multiple copies; its ability to grow to a very high cell density in bioreactors.

Method for the construction of pPICZαA::epo plasmid:

Initially Erythropoietin cDNA is amplified from the E.coli host strain which has got the plasmid pENTRTM221 with a homosapiens epo ORF and antibiotic resistance gene to kanamycin (E.Celik et al. 2007). Two forward primers EPO-F3-1 (5'CACCATATTGAAGGGAGAGCCCCACCACGCCTCATC3') and EPO-F3-2 (5'GGAATTCCACCATCACCATCACCATATTGAAGGGAG3') are designed instead of a single long primer, as an addition of 36 bases was required at the 5'-end of epo sequence (E.Celik et al. 2007). These primers amplify the cDNA of EPO by polymerase chain reaction (PCR) from pENTRTM221, and an EcoRI restriction site, 6xHis tag sequence (18 bp) and factor XA recognition sequence (12 bp) are added to the 5' end of epo sequence during amplification process (E.Celik et al. 2007). A reverse primer EPO-R3 (5'CCACGCTCTAGATTAGTCCCCTGTCCTGC3') is designed with a stop codon and XbaI restriction site at the 3'-end of the epo sequence (E.Celik et al. 2007). The shuttle vector pPICZαA (Invitrogen) is propagated in E. coli TOP10 (Invitrogen) chemically competent host cells which are grown in low-salt Luria- Bertani (LSLB) medium containing the following contents with corresponding amount (in g l-1) tryptone, 10; yeast extract, 5; NaCl, 5; Zeocin, 0.025 (Invitrogen) and are purified (E.Celik et al. 2007). Thus obtained cDNA fragment from PCR amplification and the purified vector pPICZaA are double-digested with EcoRI and XbaI (Roche, Mannheim, Germany) (E.Celik et al. 2007). Thus formed recombinant plasmids are transformed into E.coli TOP10 forming colonies (E.Celik et al. 2007). Colonies containing plasmids are to be evaluated to match the exact sequence. The isolated plasmids from Zeocin-resistant colonies are evaluated by PCR amplification using the primers 5'AOX1 (5'GACTGGTTCCAATTGACAAGC3') and 3'AOX1 (5'GCAAATGGCATTCTGACATCC3'), and by DNA sequencing in ABI 377 fluorescent sequencer (E.Celik et al. 2007). The colony which gives or matches with the exact sequence is named as E.coli pPICZαA-EPO and corresponding plasmid as pPICZαA::epo (E.Celik et al. 2007).

The construction of pPICZαA::EPO plasmid including the epo amplification, integration of specific recognition sites using regenerate primers. EcoRI and XbaI sites are shown which are used in the ligation of the insert to the vector. Linearization of the plasmid using SacI site before transformation and sequencing is also shown using the primers. (894 nucleotides are present between 5'AOX1 primer and EPO-R3 primer, 708 nucleotides are present between EPO-F3-2 primer and 3'AOX1 primer).

Adapted from (E.Celik et al. 2007) Production of Recombinant human erythropoietin from Pichia pastoris and its structural analysis. Journal of applied Microbiology volume 103 issue 6, 2084-2094.

Transformation of P.pastoris and selecting a potential rHuEPO producing strain

Now we are ready with the plasmid which needs to be integrated into Pichia Pastoris genome at the AOX1 locus. So the plasmid is linearized by SacI digestion in its AOX1 promoter region (E.Celik et al. 2007). The linearized plasmid product is purified and transformed into Zeocin-resistant single colonies of P.pastoris which are obtained at a frequency of 160 CFU µg-1 of DNA (E.Celik et al. 2007). The integration of epo gene into the P.pastoris genome at the AOX1 promoter site is verified by PCR (fig.2a) and southern blotting by using the epo insert (512 bp) as the probe (E.Celik et al. 2007). The PCR products of the expected sizes are confirmed by southern blotting (E.Celik et al. 2007). These are then grown for protein expression and the recombinant proteins from the colonies are purified by running them in SDS-PAGE and transferred to a membrane for immunoblotting (E.Celik et al. 2007). Then the strain showing the most intense band during the analysis is selected upon its production potential and is named P.pastoris E-17 (E.Celik et al. 2007).

A. P.pastoris genomic DNA template

B. Primer set of 5'AOX1 and EPO-R3 showing 894bp

C. Primer set of EPO-F3-2 and 3'AOX1 showing 708bp

Adapted from (E.Celik et al. 2007) Production of Recombinant human erythropoietin from Pichia pastoris and its structural analysis. Journal of applied Microbiology volume 103 issue 6, 2084-2094.

Production of rHuEPO:

The selected rHuEPO-producing P.pastoris E17 strain needs to be grown in an appropriate medium, so it is streaked onto YPD solid medium with the following contents and corresponding amounts (in g l-) peptone, 20; yeast extract, 10; glucose, 20; agar, 20; Zeocin, 0.100, and is incubated for 48 hrs at 30o C (E.Celik et al. 2007). A single colony is then inoculated into 5 ml of YPD and 100 µg ml-1 of Zeocin medium, and is grown in a shake flask at 225 rev min-1, and 30o C overnight (E.Celik et al. 2007). The culture is then inoculated into buffered complex glycerol medium (BMGY) containing the following contents and corresponding amounts (in g l-) yeast extract, 10; peptone, 20; yeast nitrogen base (YNB), 13.4; biotin, 4*10-5 ; glycerol, 10 and 0.1 mol l-1 of potassium phosphate buffer pH 6.0 (E.Celik et al. 2007). Growth is allowed to proceed until an OD600 of 6 is achieved (E.Celik et al. 2007). Then the cells from the medium are collected by centrifugation and these pellets are re suspended in BMMY production medium (BMGY medium containing 5 ml l-1 of methanol instead of glycerol) so that OD600 of 1 is achieved (E.Celik et al. 2007). Then the protein production is carried out in batch cultures using baffled Erlenmeyer flasks (250 ml) containing 50 ml (VR) of production medium (E.Celik et al. 2007). This is continued for 72 hrs, and every 24 hrs methanol is added to the medium to a 5 ml l-1 final concentration and at the end of 72 hrs, the medium is centrifuged at 13000 g for 10 min and the cell pellet is discarded.

Purification, deglycosylation, factor Xa digestion and obtaining native recombinant human erythropoietin

Purification is done initially by desalting the production medium by ultra filtration using nitrogen gas at 55 psi, 3.8 bar and 4oC and Amicon(400 ml) stirred pressure cells (Millipore, Bedford, MA, USA) with regenerated cellulose ultra filtration membranes having MWCO of 10 kDa (Millipore) (E.Celik et al. 2007). Then the purification of polyhistidine-tagged rHuEPO is done using cobalt-based metal affinity resins (BD Talon; BD Biosciences, Palo Alto, CA, USA) (E.Celik et al. 2007). The purified rHuEPO is then deglycosylated by digestion. For this, 50–200 µg of purified rHuEPO is dissolved in 45 µl of reaction buffer (10 mmol l-1 of Tris-HCl, pH 8.0) and 2.5 µl of denaturation solution [0.2% of sodium dodecyl sulphate (SDS), 0.1 mol l-1 of β-mercaptoethanol] is added to it (E.Celik et al. 2007). Then after denaturation at 100o C for 5 min, 2.5 µl of 1.5% NP-40 and 5 mU of N-Glycanase (Glyko, Novato, CA, USA) are added to the reaction mixture and incubated overnight at 37o C (E.Celik et al. 2007). After deglycosylation, approximately 10 g of rHuEPO is digested at 25o C for 16 hrs using 1 U of factor Xa protease ( which is removed later by Xa removal resin) which targets the Lle-Glu-Gly-Arg sequence (E.Celik et al. 2007). Then this solute is passed through the metal affinity resin to remove proteins not digested by factor Xa protease and the peptides containing the 6xHis tag (E.Celik et al. 2007). Hence we finally obtain our purified, deglycosylated and factor Xa digested recombinant human erythropoietin. Thus obtained protein corresponding to the wild type polypeptide is analysed by SDS-PAGE (lane 4 in Fig 4a) and western blotting (lane 3 in Fig 4b). Analysis shows that the apparent molecular mass of the expected size around 18 kDa which is similar to the size of wild type deglycosylated erythropoietin (E.Celik et al. 2007).

Comments

Using shake flask experiment, a density of 8 g cell dry weight l-1 is obtained (E.Celik et al. 2007) which is lower than high cell density fermentation for P.pastoris, which is 130 g cell dry weight l-1 ( Wenger 1990 ). This difference is due to uncontrolled oxygen and methane levels in the shake –flask experiment when compared to tightly controlled bioreactors. The rHuEPO produced under these conditions is >5 mg l-1 (E.Celik et al. 2007), but recombinant protein production capacities by P.pastoris cells vary from 1 to 1000 mg l-1 (Cereghino and Cregg 2000). Apart from this, rEPO produced from other nonmammalian expression systems reported a density of 0.03 mg l-1 (Elliott et al. 1989), 18 mg l-1 (Kim et al. 2005) and 20 mg l-1 (Hamilton et al. 2006). According to the above results, much higher cell concentrations of the recombinant protein is possible by optimizing the conditions of the medium and bioreactor. The synthesis of the recombinant construct which will produce a protein secreted by P.pastoris is shown in Fig.1 (E.Celik et al. 2007). It does not have the native sequence as it has elements (polyhistidine tag) used to enable its rapid purification and isolation (E.Celik et al. 2007). The C-terminal polyhistidine tag that is present in the pPICZaA vector is not employed because its removal by known methods will leave extra amino acids behind and will not help in producing a mature recombinant protein as the native form of EPO (E.Celik et al. 2007). Due of this, to digest the non native N-Terminal end of erythropoietin, a factor Xa recognition site is placed immediately at the N-terminal end of erythropoietin (E.Celik et al. 2007).

When the final product of recombinant human erythropoietin is analysed using SDS-PAGE and western blotting, it showed the apparent molecular mass of the expected size of 18kDa (E.Celik et al. 2007). This result encourages for a large scale production of the Recombinant Human Erythropoietin for the treatment of Autoimmune Haemolytic Anaemia.

References

Celik, E., Calik, P., Halloran, S.M. and Oliver, S.G. (2007) Production of Recombinant human erythropoietin from Pichia pastoris and its structural analysis. Journal of applied Microbiology volume 103 issue 6, 2084-2094.

Burke, D., Dawson, D. and Stearns, T. (2000) Methods in Yeast Genetics. New York: Cold Spring Harbor Laboratory Press.

Cereghino, G.P.L. and Cregg, J.M. (1999) Applications of yeast in biotechnology: protein production and genetic analysis. Curr Opin Biotech 10, 422–427.

Cereghino, G.P.L. and Cregg, J.M. (2000) Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol Rev 24, 45–66.

Cregg, J.M., Cereghino, J.L, Shi, J.Y. and Higgins, D.R. (2000) Recombinant protein expression in Pichia pastoris. Mol Biotech 16, 23–52.

Elliott, S., Giffin, J., Suggs, S., Lau, E.P.L. and Banks, A.R. (1989) Secretion of glycosylated human erythropoietin from yeast directed by the a-factor leader region. Gene 79, 167–180.

Hamilton, S.R., Davidson, R.C., Sethuraman, N., Nett, J.H., Jiang, Y.W., Rios, S., Bobrowicz, P., Stadheim, T.A., et al. (2006) Humanization of yeast to produce complex terminally sialylated glycoproteins. Science 313, 1441–1443.

Kim, Y.K., Shin, H.S., Tomiya, N., Lee, Y.C., Betenbaugh, M.J. and Cha, H.J. (2005) Production and N-glycan analysis of secreted human erythropoietin glycoprotein in stably transfected Drosophila S2 cells. Biotech Bioeng 92, 452–461.

Sambrook, J. and Russell, D. (2001) Molecular Cloning: A Laboratory Manual, 3rd edn. New York: Cold Spring Harbor Laboratory Press.

Wegner, G. (1990) Emerging applications of the methylotrophic yeasts. FEMS Microbiol Rev 7, 279–283.

UK Essays Live Chat