Rainbow in a Bottle

The Amazing Race - Rainbow in a Bottle

Introduction

Produce a quick and moving rainbow of colors with an Alka-Seltzer® tablet and a little vinegar.

Chemical Concepts

• Acid-base reactions

• pH indicators

Materials (for each demonstration)

Alka-Seltzer, 1 tablet

Vinegar, CH3CO2H, 10 mL

Sodium hydroxide, NaOH, 0.1 M, 100 mL

600-mL Beaker

Universal indicator, 10 mL

Graduated cylinders; 500-mL, 100-mL and 10-mL

Water, distilled, 350 mL

Stirring rod

Pens and pencils

mRNA sequences on different coloured sheets

Strips of white paper

Pins or clips

Amino acid reference chart

Safety Precautions

Sodium hydroxide is a corrosive liquid, skin burns are possible and it is dangerous to the eyes. Universal indicator is an alcohol-based solution and thus a flammable liquid. Wear chemical splash goggles, chemical-resistant gloves, and a chemical-resistant apron. Please consult current Material Safety Data Sheets for additional safety information.

Each student will be given a strip of mRNA sequences, each on a different coloured strip, and an amino acid reference chart. Some students may need to be given more than one strip. Each strip will be translated using the reference charts and will code for one procedure required to complete the challenge. The procedures will need to be translated as codons into a letter (the amino acid symbol). For example, if the codon reads AUG, which codes for the amino acid methionine, the symbol and letter would be “M”. After students have completed translating their procedure onto the white slips of paper, they are to arrange them in order of increasing wavelength based on the colour of the strip from which their procedure was translated. Each student will carry out his or her procedure. If the reaction produces “rainbow” colours, the team has completed their mission successfully. The team who completes this challenge in the least amount of time will win.

TIE BREAKER: The students must write down on a strip of paper the type of reaction they saw during this challenge. The team who takes the least amount of time to complete this correctly will win. Some of the slips of papers will have hints that must be translated. When it comes time to completing the tie breaker at the end of the activity/reaction, group members can congregate and use their hints to come up with an answer to the tie breaker question. All reagents will be laid out with labels so that students can refer to them throughout the activity.

N.B. The arrow symbol à means “to”.

Procedure:

1. Measure out approximately 350 mL of distilled water in a 600-mL beaker (Label A).

2. Add 100 mL of 0.1 M sodium hydroxide solution (Label M).

3. Add 10 mL of the universal indicator solution (Label C) and stir. The solution should now be a dark purple.

4. Pour the solution into a 500-mL graduated cylinder (Label D).

5. Use a clean graduated cylinder to measure out 10 mL of vinegar (Label E). 6. Drop an Alka-Seltzer tablet (Label F) into the 500-mL graduated cylinder. Color changes should begin to occur as soon as the first carbon dioxide bubbles are formed. 7. When the tablet rises to the top, add about 10 mL of vinegar (Label E) to the solution. The solution should now be red on the top. Continually stir with the stirring rod (Label G).

Background

The Alka-Seltzer tablets contain sodium bicarbonate and citric acid. As the Alka-Seltzer tablet dissolves in water, the citric acid reacts with the sodium bicarbonate to produce carbonic acid (Equation 1) and carbon dioxide (Equation 2). The carbonic acid then reacts with the basic sodium hydroxide to change the pH of the solution (Equations 3 and 4). As the base is consumed, the solution will slowly become more acidic, resulting in the color changes.

The Alka-Seltzer tablet initially sinks to the bottom of the cylinder. As the carbon dioxide bubbles adhere to the tablet, the tablet begins to rise and eventually floats. The buoyancy of the tablet and the final addition of vinegar (a weak acid) lead to a pH gradient. Universal indicator makes the pH gradient visible and produces the characteristic rainbow of colors.

Procedures (mRNA): Remember that each of these procedures will be printed on a different coloured paper as indicated below. When these instructions are printed out, do not include the procedure number.

1 = PURPLE 2 = BLUE 3 = GREEN

4 = YELLOW 5 = ORANGE 6 = RED

1. GCAGACGAU UGUCAUGAAAUGAUUUGUGCAUUA “AUG” à

UGCCACGAGAUGAUAUGCGCACUA “GCC”.

AGUAUGAUUUUAGAG!

2. GCAGACGAU UGUCAUGAAAUGAUUUGUGCAUUA “UGC” à

UGCCACGAGAUGAUAUGCGCACUA “GCC” GCCAACGAC

AGUACCAUCAGA UGGAUCACACAU “GGC”.

3. GCAGACGAU UGUCAUGAAAUGAUUUGUGCAUUA “GCC” à

“GAC”. CAUAUCAAUACC: GUCAUCAAUGAAGGUGCUCGC.

AGUAUGAUUUUAGAG!

4. GCAGACGAU GCC “UUU” à “GAC”.

CAUAUCAAUACC: AAAUUU.

UCCUGUAUUGAGAAUUGCGAA AUCAGC

GGCCGAGAGGAAGCCGCGACG!

5. UGGCAUGAAAAU “UUU” AGGAUCUCCGAGUCA,

GCAGACGAU UGUCAUGAAAUGAUUUGUGCAUUA

“GAA” à “GAC”.

6. AAAGAGGAACCC AGUACCAUCAGACGCAUCAACGGC

UGGAUCACACAU “GGC”. UCCUGUAUUGAGAAUUGCGAA

AUCAGC GGCCGAGAGGAAGCCGCGACG!

Procedure (Translated):

1. Add chemical “M” à chemical “A”. Smile!

2. Add chemical “C” à chemical “A” and stir with “G”.

3. Add chemical “A” à “D”. Hint: vinegar. Smile!

4. Add a “F” à “D”. Hint: KF. Science is greeaat!

5. When “F” rises, add chemical “E” à “D”.

6. Keep stirring with “G”. Science is greeaat!


Please be aware that the free essay that you were just reading was not written by us. This essay, and all of the others available to view on the website, were provided to us by students in exchange for services that we offer. This relationship helps our students to get an even better deal while also contributing to the biggest free essay resource in the UK!