Metal experiments

Metal experiments


Effectofmetalions(Mg2+,Zn2+andFe3+)ontheproductionoffusaricidin type antifungal compoundsby Paenibacillus polymyxaSQR-21wasstudiedinliquidculture. First, one-factor; three-level experiments were conducted to find out optimal concentrations of each metal ion for maximum production of fusaricidins. Later, three-factor; five-level experiments were performed and a quadratic predictive model was developed using response surface methodology (RSM). The results indicated that Fe3+ and Mg2+ positively affected the growth of P. polymyxa as determined by measuring the OD600 of the liquid culture. The production of fusaricidin type antifungal compounds was significantly inhibited by Zn2+ (P = 0.0114) and increased by Mg2+ (P = 0.0051) but the effect of Fe3+ (P = 0.2157) was non-significant. However, a synergistic positive effect of Mg2+ and Fe3+ on the production of antifungal compounds was observed. This study sheds lights on the pertinent effects of the individual and combined metal ions on the production of fusaricidins in P. polymyxa. It provides the key information for optimization of the metal ions in the fermentation media to achieve the maximum antibiotic production in this strain.

1. Introduction

Metals are an integral part of all ecosystems. Some of them are vital components of living systems and known as essential metal ions [1]. Secondary metabolisms are affected by the presence or absence of these essential metal ions, as they may be responsible for activation of some of the biosynthetic pathways [2]. This regulatory effect of metal ions on microbial secondary metabolism has been recorded for a variety of species [3], but little work has been reported for Paenibacillus species. Among Paenibacillus spp., P. polymyxa strains are capable of suppressing plant diseases caused by soil-borne pathogens and promoting plant growth [4]. P. polymyxa strains are known to produce two types of peptide antibiotics. One group comprises the antibiotics active against bacteria, including the polymyxins, etc. [5]. The other group is made up of the peptide antibiotics active against fungi and gram-positive bacteria and includes fusaricidins A, B, C, and D [6, 7]. In addition, there are many reports where the nature of the inhibitory agent is undefined [8]. In this experiment, we used P. polymyxa strain SQR-21 (P. polymyxa)that was checked for all possible antibiotic compounds and was found to produce only fusaricidin type of antifungal compounds, Fusaricidin A, B, C and D, composed of a group of cyclic depsipeptides that have molecular masses of 883, 897, 948, and 961 Da, respectively, with an unusual 15-guanidino-3-hydroxypentadecanoic acid moiety bound to a free amino group [6]. The fusaricidin biosynthetic gene cluster was cloned and sequenced. It spans 32.4 kb, including an open reading frame, coding for a six-module nonribosomal peptide synthetase [9].

We studied the effect of three metal ions (Mg2+, Zn2+, Fe3+) on fusaricidin production by P. polymyxa, as previous reports have indicated that these metals ions can affect the production of antifungal compounds. For example, Mg2+ up to 1.25 mM, increased bulbiformin production and growth of Bacillus subtilis [10]. In Streptomyces sp., Fe3+ is requiredfor production of the antibiotics actinomycin,neomycin, streptomycin and chloramphenicol [11]. The extracellular antifungal antibiotic production by Streptomyces galbus was promoted by the addition of 200 µM Zn2+ [12].

Studies involving the effect of individual metal ions on the production of metabolic products by microorganisms can be informative, but in natural environment, metals are present together at various concentrations. Thus, there is a need to evaluate their interactive behavior so that we can develop optimal recipe concentrations to produce maximum amounts of metabolic products. The traditional “three-factor; three-level” technique used for optimizing a multi-variable system with all potential combinations, not only require many experiments but also may result in wrong conclusions. Under these circumstances, RSM is an attractive alternative that can be used to study the effect of several factors that influence the dependent responses by varying the factors simultaneously and carrying out a limited number of experiments [13]. RSM has been successfully applied in many areas of biotechnology such as enzymatic saccharification, ethanol fermentation [13] and eucalyptene A optimization [14]. However, it has not previously been used to study and evaluate the effect of metal ions on fusaricidin-type antifungal compounds production. Thus, experiments were planned to investigate the effect of three metal ions (Mg2+, Zn2+, Fe3+) on growth and fusaricidins production by P. polymyxa and to develop a quadratic predictive model. In addition, the effect of most effective metal ions combination on overall metabolic activity of P. polymyxa was also determined by measuring intra and extracellular proteins and carbohydrates, intracellular lipid and total RNA contents.

2. Material and Methods

2.1. Bacterial and fungal cultures

A fusaricidin producing strain, P. polymyxa SQR-21 was isolated from the rhizosphere soil of healthy watermelon plant from a heavily wilt diseased field (GenBank Accession no. FJ600406). A tested pathogenic strain Fusarium oxysporum f. sp. cucumerinum (F. oxysporum) were provided by the soil-microbe interaction laboratory, Nanjing Agriculture University, Nanjing, China. The P. polymyxa SQR-21 bacterial culture was maintained on Luria Bertani (LB) agar plates and was stored at -80 ℃ in tryptic soya broth (TSB) containing 20% glycerol for further use. The fungal pathogenic strain, Fusarium oxysporum, was maintained by cultivation on potato dextrose agar (PDA) plates for 3 days at 28 ℃ and then the plates were sealed with parafilm and stored at 4 ℃. The pathogen was subcultured onto a fresh PDA plate after one month.

2.2. Preparation of metal ion media

Liquid-culture experiments were performed in 500 ml of tryptone broth (tryptone, 10; NaCl, 5 and sucrose, 10 g L-1; pH 7.5). Initial Mg2+, Zn2+ and Fe3+ contents in tryptone broth, determined by Spectra AA, 220 FS atomic absorbance spectrometer, were 100, 4, and 10 µM, respectively. For the estimation of optimal concentration of each metal ions needed to produce maximum fusaricidin type antifungal compounds by P. polymyxa, a series of one-factor; three-level experiments were conducted. The levels considered, in the final one-factor, three-level experiments, for Mg2+ were 0.65, 1.3 and 2.6 mM and for Zn2+ and Fe3+ these levels were 25, 50 and 100 µM each. Each experiment had three replicates including control cultures without supplemented metal ions. The final one-factor; three-level experiment was conducted twice for each metal ion.

For the isolation of antifungal compounds, tryptone broth was inoculated with overnight culture of SQR-21 in TSB and incubated in an incubator shaker (170 rpm, 30oC). After 4 d, OD600 was measured and for the quantification of fusaricidins, liquid culture was centrifuged at 12000 × g for 10 min and antifungal compounds were extracted with an equal volume of n-butanol twice, concentrated by rotary evaporator and dissolved in methanol (1 ml). These extracts were used to determine fusaricidins production by agar diffusion assay against F. oxysporum (150 µL in each well). The diameter of inhibition zone was measured after 48 h and fusaricidins concentration was determined by comparing with standards. The standards were developed by using 5-25 µg ml-1 of purified fusaricidins in methanol against F. oxysporum. The treatment differences were assessed with one-way ANOVA. Duncan's multiple-range test was applied when one-way ANOVA revealed significant differences (P≤0.05). All statistical analysis was performed with SPSS BAS Ever.11.5 statistical software (SPSS, Chicago, IL).

The metal concentrations that showed maximum fusaricidins production were used as the highest level (+1 level) for interactive study (three factor; five level experiments). For the interactive study experiment, the tryptone medium was sterilized and the cultures were supplemented with MgSO4, ZnSO4 and FeCl3, for Mg2+, Zn2+ and Fe3+, respectively. Each experiment was repeated twice with three replicates.

2.3. Extra and intracellular chemical composition

The effect of metal ions on the extra and intracellular chemical composition of P. polymyxa was determined by measuring intra (IP) and extracellular protein (EP), intra (IC) and extracellular carbohydrate (EPS) and intracellular lipid (IL) contents. The P. polymyxa liquid culture (tryptone broth) samples (2 ml) were centrifuged (12,000 x g) for 10 min. The pellets were suspended in 2 ml of deionized water for washing and centrifuged three times. These pellets were used for the determination of total intracellular protein, carbohydrate and lipid contents. For total protein contents, the washed cells were resuspended in deionized water and incubated in 1 N NaOH at 90℃ for 10 min to solubilize cellular protein. Proteins were measured according to Bradford [15] with bovine serum albumin standards ranging from 10 to 100 µg ml-1. Total carbohydrate was estimated by the phenol-sulfuric acid method [16]. The lipid contents of bacterial cells were measured using the phosphoric acid-vanillin reagent method of Izard and Limberger [17] with Triolein standards ranging from 10 to 100 µg. The cell free liquid culture was used for the estimation of extracellular protein and polysaccharide (EPS) contents by the above-described methods. Before assaying protein, the resulting EPS solution was dialyzed using a membrane of 1000 Da molecular weigh cut-off against ultra pure water for 2 days at 4℃ to remove the small molecules and entrained media residues.

2.4. RNA extraction and primers design

To check the expression of fusaricidin synthetase gene (fusA), total RNA was isolated using Trizol reagent (Invitrogen, Shanghai) according to manufacturer's instructions. To remove DNA contamination, 10 U DNase1 (Takara, Dalian) along with 20 U RNase inhibitor (Takara, Dalian) (37oC, 40 min) were used in the reaction mixture of 50 µl containing 20-50 µg RNA. RNA was estimated by measuring the absorbance at 260 nm. Specific primers for fusA (111 bp) and 16s RNA gene (16s) (210 bp) were designed by using primer premier 5 software (PREMIER biosoft international). The designed primers were as follows, fusA1, 5' GCAGAGGATGATAGTGTTGGTC 3', fasA2, 5' CAGCACATCATGCGTTCC 3', 16s1, 5' CATTCATCGTTTACGGCGT 3' and 16s2, 5' TGTTAATCCCGAGGCTCACT 3'.

2.5. Reverse transcription and Real Time PCR assay

For the synthesis of first strand cDNA, 3 µg of RNA, 200 U of RevertAid M-MuLV reverse transcriptase (Fermantas), 20 U RNase inhibitor (TaKaRa, Dalian), 0.2 µg of random hexamer primer and 1 mM dNTP in the total volume of 20 µl were used. RT was performed by denaturation at 65oC for 5 min, incubation at 42oC for 60 min and inactivation at 95o C for 5 min. Target genes from cDNA were amplified separately using 3 µl aliquots of RT product as template and 30 pmol of each primer pair (fusA1 and fusA2, 16s1 and 16s2). Reaction mixtures for PCR contained 2.5 U Taq polymerase, 20 nmol of dNTP and 100 nmol Mg2+. The PCR protocol included incubation at 95°C for 5 min, followed by 30 cycles, each including 94°C for 30s, 58°C for 30s, 72°C for 1 min and then at 72°C for 2 min. Amplified products were separated, stained and viewed to check the band intensity and cDNA quality. Singleplex relative Real Time PCR was performed using an iCycler MyiQ single color Real Time PCR detection system (BioRad). Reactions mixtures (20 µl) contained 1 mM primers, 3 µl cDNA and 10 µl of SYBR®Premix Ex Taq (Perfect Real Time) (TaKaRa, Dalian) including TaKaRa Ex Taq HS and SYBR® Green I, dNTP and buffer. The PCR protocol included a denaturation at 95o C for 10 min followed by 40 cycles with 95oC for 30 s, 58oC for 30 s and 72oC for 1 min. Detection of the fluorescent product was carried out at the end of the 72o C extension period (2 min). After the PCR, these samples were heated from 58 to 95o C. When the temperature reaches the Tm of each fragment, there was a steep decrease in fluorescence of the product. The 2 µl cDNA of each treatment were mixed together to prepare relative standards. The whole experiment was repeated twice.

2.6. Methodology and design of experiments

The most common experimental design in RSM is the Central Composite Design (CCD) [18]. In our study, the CCD allowed us to develop a quadratic predictive model that had a minimal number of experimental runs. The CCD used was generated by ‘‘Design-Expert” software (Trial version 7.1.6; Stat-Ease, Inc., Minneapolis, MN, USA). According to this design, 20 experiments containing six replications were conducted at the center point for estimating the purely experimental uncertainty variance in triplicates. The parameters for three metal ions (Mg2+, Zn2+ and Fe3+) were chosen as main variables and designated as x1, x2 and x3, respectively. The low, middle and high levels of each variable were designated as -1.68, -1, 0, +1 and +1.68.

The behavior of the system was explained by the following second-degree polynomial equation:

where Y is response; b0 is a constant, bi is the linear coefficient, bij is the second-order interaction, and bjj is the quadratic coefficients. The variable, xi, is the non-coded independent variables. It must be noted that in the present study, three variables are involved and hence n takes the value 3. Thus, by substituting the value 3 for n, Eq. (1) becomes:

Y = B0 + B1x1 + B2x2 + B3x3 + B12x1x2 + B13x1x3 + B23x2x3 + B11x21+ B22x22 + B33x23 (2)

where Y is the predicted response, and x1, x2 and x3 are input variables. B0 is a constant and B1, B2 and B3 are linear coefficients. B12, B13 and B23 are cross product coefficients and B11, B22 and B33 are quadratic coefficients.

3. Results and Discussion

3.1. One factor; three level experiments

For the estimation of optimum concentration of each metal ion for maximum production of fusaricidins, the influence of one factor (one metal ion) was determined with three concentration level experiments (Table 1). The results revealed that Zn2+ and Fe3+ significantly increased the growth, as measured by optical density (OD600) of P. polymyxa while the effect of Mg2+ on growth of P. polymyxa was nonsignificant. The increase in the concentrations of Zn2+, Fe3+ and Mg2+ in the liquid culture increased the production of fusaricidins and the relative expression of fusA gene. However, at the highest levels of Fe3+ (100 µM ) and Mg2+ (2.6 mM), decrease in the production of fusaricidins and in the relative expression of fusA gene was determined. The expression of positive control gene 16s RNA was remained nearly constant among all treatments. Four kinds of fusaricidins were produced by P. polymyxa that were eluted in two peaks [6] but their production ratio was not affected by the metal ions so the quantity of fusaricidins presented in the results, represents total amount of fusaricidins. To determine the effect of metal ions alone on the overall metabolic activity of P. polymyxa SQR-21, intracellular protein (IP), lipid (IL) and carbohydrate (IC) contents, extracellular protein (EP) and polysaccharide (EPS) contents and RNA contents were determined. The results showed that the increase in the concentration of Mg2+ in the liquid culture increased the IP, IC, EPS and RNA contents (except at the highest level, 2.6 mM Mg2+), however, maximum IL and EP contents were determined at 0.65 mM Mg2+ concentration. The increase in the concentration of Fe3+ in the liquid culture increased the IC, EP and EPS contents while the effect on IP contents was nonsignificant. The maximum IL contents were determined at 25 and maximum RNA contents were determined at 50 µM Fe3+ concentration. The increase in the concentration of Zn2+ in the liquid culture decreased the IP, IL, IC, EPS and RNA contents. The maximum EP contents were determined at 50 µM Zn2+ concentration, while the EP contents at all other concentration levels of Zn2+ were nonsignificant with each other. The effect of these metal ions on antibiotic production by different microbes has been reported earlier. MgSO4 at 2 mM concentration increased iturin A production by Bacillus amyloliquefaciens B128 [2]. Addition of Zn2+ has a stimulatory effect on the activity of fatty acid synthetase and on aflatoxin B1 production in Aspergillus parasiticus [19]. Concentrations of Fe3+ up to 1.8 M had stimulatory effects on the production of antitubercular antibiotic rifamycin by Nocardia mediterranea A TCC 13685 [20].

3.2. Three factor; five level experiments

The values of the responses (fusaricidins type antifungal compounds and OD600) obtained under the different experimental conditions are summarized in Table 2.

By applying multiple regression analysis to the experimental data of fusaricidin type antifungal compounds, the response and test variables were found to be related by the following second-order polynomial equation:

YFusaricidins = 11.57 + 1.06x1 - 0.92x2 + 0.39x3 - 0.99x1x2 - 1.56x1x3 - 0.14x2x3 + 1.88x12 + 0.44x22 + 1.58x32 (3)

By applying multiple regression analysis to the experimental data of OD600, the response and test variables were found to be related by the following second-order polynomial equation:

YOD600 = 0.89 + 0.025x1 - 0.008x2 + 0.11x3 + 0.016x1x2 + 0.018x1x3 + 0.040x2x3 + 0.0049x12 - 0.0021x22- 0.054x32 (4) The correlation measure for testing the goodness of fit of regression equation is the adjusted determination coefficient R2Adj. The values of R2Adj, 0.8440 for Eq. (3) and 0.7547 for Eq. (4), indicate a high degree of correlation between the observed and predicted values for the production of fusaricidins and OD600, respectively. Statistical testing of the model was done in the form of analysis of variance (ANOVA). The regression model demonstrates that the model is highly significant, as is evident from the calculated F-values (12.42 for fusaricidins type antifungal compounds and 7.49 for OD600) and a very low probability values (P = 0.0002 for fusaricidins type antifungal compounds (Table 3) and 0.0021 for OD600 (data not shown). The model also shows statistically non-significant (P > 0.05) lack of fit for production of fusaricidins and OD600 as is evident from greater computed F-values than the tabulated F-values (F0.05 (9, 5) = 4.77). The model was, therefore found to be adequate for prediction within the range of variables employed. The coefficient values of Eq. (3), calculated and tested for significance using the ‘‘Design-Expert” software, indicate that the linear coefficients (x1, x2), quadratic term coefficients (x12, x32) and cross product coefficient (x1x2,x1x3) are significant and the other term coefficients (x3, x22and x2x3)are not significant (Table 4).

The graphical representations of regression Eq. (3), termed as the response surface plots were obtained using the Design Expert software. Fig. 1A shows the 2D response surface plot at varying Mg2+ and Zn2+ concentrations at a fixed Fe3+ concentration of 37.5 µM (0 level). From Fig. 1A, it can be seen that the fusaricidins production decreased with an increase in concentration of Zn2+ and increased with an increase in concentration of Mg2+. This is an example of an interactive effect between Mg2+ and Zn2+. Analyzing the Mg2+-Fe3+ plot (Fig. 1B), a significantly (P < 0.05) positive synergistic interactive effect on fusaricidins production was observed at a fixed Zn2+concentration of 112.5 µM. The 2D response surface in Fig. 1C, which gives the fusaricidins production as a function of Zn2+ and Fe3+ concentrations at a fixed Mg2+ concentration of 0.98 mM (0 level), shows that the fusaricidins production decreased with an increase in the concentration of Zn2+ and increased with an increase in concentration of Fe3+.

These results showed that Mg2+ was most effective metal ion for increasing fusaricidins production by P. polymyxa. The effectiveness of Mg2+ to increase the production of fusaricidins is further supported by Wang and Liu [13] who reported that Mg2+ was the most effective ion that stimulated the production of polymyxin E by P. polymyxa Cp-S316. In addition, Mg2+ was an essential element for the production of PA-5 and PA-7 type antibiotics. This was probably due to its effect on the Mg-requiring acetyl-CoA-carboxylase activity as shown in Streptomyees strains [21]. The enzyme involved in the synthesis of β-lactam antibiotics, L-aminoadipyl-L-cysteinyl-D-valine (LLD-ACV) synthetase, also needs Mg2+ for the activation of each amino acid [22]. The Fe3+ also showed a positive synergistic effect on fusaricidins production with Mg2+ ion. The Fe3+ is most important micronutrient used by bacteria and is being required as a cofactor for a large number of enzymes and iron-containing proteins. As Lubbe et al. [23] reported that the complete cephamycin pathway benefited from the higher iron concentration. Three of the enzymes common to the cephalosporin C and cephamycin C biosynthetic pathways are known to require iron in their catalytic activities, namely isopenicillin N synthase (IPNS), deacetoxycephalosporin C synthase (DAOCS), and deacetoxycephalosporin C hydroxylase (DAOCH).

The data obtained in this experiment clearly depicted that metals ions alone and in different combinations differently affect metabolites production. The optimum concentrations of metals ions required for the maximum fusaricidins production observed in one-factor, three-level experiments were 1.3 mM, 150 µM and 50 µM for Mg2+, Zn2+ and Fe3+, respectively. However, when their interactive effects were observed then Zn2+ in combination with Mg2+ and Fe3+ inhibited the production of fusaricidins. However, the interactive effect of Mg2+ with Fe3+ was positively synergistic. The maximum production of fusaricidin type antifungal compounds (20.6 µg ml-1) was measured at 75 (-1), 25 (-1) µM and 1.3 mM (+1) levels of Zn2+, Fe3+ and Mg2+, respectively. Similar kinds of effects of these metal ions have been reported on metabolites production by other microorganisms. For example, Mg2+ up to 1.25 mM increased bulbiformin production by Bacillus subtilis [10], Zn2+ at a concentration of 2-3 mM nearly stopped the pigmentation and antibiotic production of both wild type and strain NI IS in liquid medium [24], ferric iron (250-1000 µM) enhanced zwittermicin A accumulation and disease suppression [25].

The data regarding the interactive effect of metal ions on bacterial growth indicates Mg2+ and Fe3+ together increased the growth of P. polymyxa in liquid culture.However, Zn2+ caused a slight decrease in the growth of P. polymyxa, as was also depicted from Eq. 4. The maximum growth, as determined by measurement of OD600 (value of 0.97), was obtained for the combination of Zn2+, Fe3+ and Mg2 at concentrations of 100 (+1), 50 (+1) µM and 1.3 (+1) mM, respectively. These results are in agreement with previous reports that the supplementation of the medium with Mg+2 stimulated the growth of Zalerion arboricola [26].Fe3+ has a marked effect on growth of Bacillus subtilis [27] and Zn+2 decreased the growth of Monascus purpureus [24].

3.3. Effect of optimal metal ion concentrations on overall metabolic activity of P. polymyxa

The combination of metal ions concentrations that gave maximum fusaricidins production was used to identify their effect on overall metabolic activity of P. polymyxa. The results showed (Fig. 2) that OD600 (i.e growth of bacteria), IP, IC and RNA contents and relative expression of fusA gene were increased by 38, 5, 8, 15 and 89%, respectively, while the EP, EPS and IL contents were decreased by 26, 2 and 37% over control, respectively. These results, in combination with the results of the effect of these metal ions alone on overall metabolic activity of P. polymyxa where Fe3+ and Mg2+ alone increased most of tested parameters while the effect of Zn2+ was inhibitory, clearly showed that these metal ions (Zn2+, Fe3+ and Mg2+) have a regulatory role, either directly or indirectly, on bacterial secondary metabolism, mainly in the production of fusaricidins. The increase in the concentrations of IP, RNA and especially relative expression of fusA gene indicated that the production of some enzymes, involved in fusaricidins synthesis, growth or other activities related to different cellular processes might be increased. This resulted in a simultaneous decrease in the IL contents as residual energy was being used for the IP and IC synthesis that promoted the expression of proteins involved in the fusaricidins production. The EPS that P. polymyxa form, arethought to play a crucial role in metal biosorption and precipitation as P. polymyxa strains have been used in the biosorption of Cu [28] but the combination of metal ions that produced maximum fusaricidins decreased the EPS production. The biological and chemical characteristics of these uptake processes are important as an aid in the understanding of the role of metallic ions in basic cellular functions. The decrease in EP and EPS concentrations in the presence of Zn2+ indicated the toxic effect of this metal ion on extracellular enzyme production. This conclusion was further supported by the results of one factor with three concentration levels experiments where Zn2+ decreased IP, IL, IC, EPS and RNA contents of P. polymyxa. These toxic effects of Zn2+ are in agreement with previous findings when Zn2+, at concentrations of 2-3 mM, nearly stopped the pigmentation and antibacterial activity of both wild type and strain NI IS in liquid medium [24].

The presence, during growth, of different metal ions such as Ca2+ and Mg2+, as well as oxide minerals of iron, aluminium and calcium, influence the types and quantity of polysaccharides, proteins and enzymes secreted by bacteria [29]Reed, G., 1987. Industrial Microbiology, 4th ed. CBS Publishers, New Delhi.Reed, G., 1987. Industrial Microbiology, 4th ed. CBS Publishers, New Delhi.. The mechanisms of how metal ions increased or decreased the growth and antibiotic production are obscured and have not yet been elucidated. In our case, metal ions might be interfering with secondary metabolism more than other enzymes or cellular processes. They may have stimulated or suppressed the synthesis of the prepeptide or the activation of the appropriate prepeptide maturation enzymes and the transport out of the cell. Recently, Ca2+ binding sites were predicted to be present in NisP peptidase, which cleaves the leader peptide from the precursor nisin [30]. Since the precursor is devoid of antibacterial activity [31], metal ions are thought to be involved in the activation or inactivation of the leader peptidase. The increase in the concentration of antibiotic in the medium can be the result of increase in cell wall permeability of P. polymyxa promoted by metal ions. This is in agreement with Petit-Glatron et al. [32], who studied the capacity of the cell wall to concentrate Ca2+ and proposed that the increased concentration of Ca2+ in the microenvironment of the cell wall could play an important role in the last step of the secretion. Another possibility is that the metal ions activated enzymes whose activity results in a change in the regulatory functions of the cell in favor of different secondary metabolites, especially fusaricidins.

The results clearly show the marked advantage of using RSM that allowed us to obtain a regression equation predicting the growth and fusaricidins production by P. polymyxa and can identify which of the metal ions are most important in this process. This regression equation model is the first application of RSM to describe the effect of metal ions on the production of fusaricidins type antifungal compounds by P. polymyxa. The fusaricidins have great potential for industrial use according to the recent reports on its germicidal activity against pathogenic Gram-positive bacteria and plant pathogenic fungi and thereby fusaricidins are in increasing demand [4, 6]. So this information will aid in developing fermentation technology for maximum antibiotic production under laboratory and commercial fermentation conditions. More research is needed at the cellular level, however, to evaluate the behavior of metal ions alone and in the combinations on fusaricidins production by P. polymyxa.

Please be aware that the free essay that you were just reading was not written by us. This essay, and all of the others available to view on the website, were provided to us by students in exchange for services that we offer. This relationship helps our students to get an even better deal while also contributing to the biggest free essay resource in the UK!