Mutation changes

How do Mutations Occur?

A mutation is a permanent change in the DNA sequence of a gene. Sometimes mutations in DNA can cause changes in the way a cell behaves. This is because genes contain the instructions necessary for a cell to work. If some of the instructions to the cell are wrong, then the cell may not know what it is supposed to do!

There are two ways in which DNA can become mutated:

Mutations can be inherited. This means that if a parent has a mutation in his or her DNA, then the mutation is passed on to his or her children.

Mutations can be acquired. This happens when environmental agents damage DNA, or when mistakes occur when a cell copies its DNA prior to cell division.

Want to find out more about what causes DNA mutations?

Molecular biology web bok

http://www.web-books.com/MoBio/

Mutation, Mutagens, and DNA Repair

http://www-personal.ksu.edu/~bethmont/mutdes.html

Kansas state university

I. Introduction: Definitions and mutation rates

We have been using the term 'mutation' pretty loosely up to this point in the course...now we need to define it more precisely: mutation-- a change in the genetic material (ie. DNA). We are going to spend some time talking about how mutations can occur and what their consequences may be to cells; we will also be looking at the ways in which cells avoid mutations by repairing DNA damage.

Why this focus? Why are mutations important? There are several reasons: 1) they may have deleterious or (rarely) advantageous consequences to an organism (or its descendants); 2) they are important to geneticists: the most common way we study something is to break it--ie., we search for or make a variant (mutant) lacking the ability to perform a process which we want to study. These genetic variants possess mutant alleles of the genes we are interested in studying. 3) Mutations are important as the major source of genetic variation which fuels evolutionary change (as we will see later when we talk about population genetics and evolution).

Let's further define mutation as a heritable change in the genetic material. This point becomes important in multicellular organisms where we must distinguish between changes in gametes (germline mutations) and changes in body cells (somatic mutations). The former are passed on to one's offspring; the latter are not but we will see they can be very important in causing cancer.

In detection of germline mutations in humans and measurement of human mutation rates we have the problem of diploidy. Most forward mutations (normal gene to mutant form) are recessive and so won't be detected unless a zygote gets two copies of the mutant allele. [Reversion or reverse mutation (mutant back to normal) is generally much less frequent because there are a lot more ways to "break" a gene than there are to reverse an existing mutation.] So how can we detect and measure rates of new mutations? We can look at dominant mutations on occuring on the autosomes and at both recessive and dominant mutations on the X chromosome, since males are hemizygous for X-linked genes. Example: achondroplasia occurs sporadically (in families with no previous history) as a result of new mutations in the gene for the fibroblast growth factor receptor. One study detected seven infants born with sporadic achondroplasia in one year among 242,257 total births recorded. So the rate (actually a frequency but we won't be concerned about the difference for the purposes of thinking about rates in this course) is 7/242,257 x 1/2 (2 alleles per zygote) = 1.4 x 10e-5.

This rate is roughly in the middle of the range reported for various human genes: those with high mutation rates like NF1 (neurofibromatosis type 1) and DMD (Duchenne muscular dystrophy) (ca. 1 x 10e-4) and those with low rates of new mutation like the Huntington's Disease gene (1 x 10e-6). This hundred-fold range shows that mutation rates per gene can be intrinsically different.

Why might this be? Two possible explanations are: 1) target size and 2) hot spots. Some genes are large, meaning that there are many bases at which mutations could alter or disrupt their function. The large target argument could well be responsible for the high rates of mutation of the NF and DMD genes, as these are known to have very large protein coding regions. Alternatively, some genes may be in regions of chromosomes which are more susceptible to genetic damage/change or may contain sequences which are more likely to be altered by spontaneous mutations; the achondroplasia gene is known to contain a hot spot of the latter type (a CpG sequence, discussed below).

From studies like these in vivo and others using human cells in vitro, the overall human mutation rate is estimated to be about 1 x 10e-6 per gene per generation. (Therefore the HD gene rate is probably more typical than the other genes mentioned above.) This rate is similar to those measured in various prokaryotic and eukaryotic microorganisms. We can use the estimated human mutation rate to determine its impact on the likelihood of changes occurring in each generation: a rate of 1 x 10e-6 mutations/gene x 5 x 10e4 genes/haploid genome = 5 x 10e-2 mutations per gamete (=5/100 or 1/20). 1/20 x 2 gametes per zygote = 1/10 chance that each zygote carries a new mutation somewhere in the genome. This seems like a very high number but we need to remember that most mutations are recessive and thus will not be expressed in the heterozygous condition.

II. Types of Mutations

Mutations, or heritable alterations in the genetic material, may be gross (at the level of the chromosome, which we have already discussed) or point alterations (this technically means mutations not visible as cytological abnormalities and/or those which map to a single "point" in experimental crosses). The latter can involve just a single nucleotide pair in DNA. In this section, we will be considering small changes in DNA, of the point mutation type.

A. Base pair (nucleotide pair) substitutions

These are of two types: transitions (purine to purine or pyrimidine to pyrimidine) and transversions (purine to pyrimidine or pyrimidine to purine). We break these down into the two categories because they can occur in different ways.

The consequences of base substitution mutations in protein coding regions of a gene depend on the substitution and its location. They may be silent, not resulting in a new amino acid in the protein sequence, eg. GCA or GCG codons in mRNA both mean arginine [this is often true in the third position of a codon, especially with transitions because of "wobble" base pairing]. A base substitution could also result in an amino acid substitution; this is referred to as a missense mutation. For example, CTC in the DNA sense strand [GAG in mRNA] will specify a glutamate residue in the protein; this is altered to CAC in the DNA or GUG in the mRNA, resulting in a valine residue in the beta-globin protein chain causing sickle-cell anemia. Missense mutations may have very serious consquences, as in the case of sickle-cell anemia, mild consequences as in the case of hemoglobin C (a different amino acid substitution in position 6 of beta-globin) or no phenotype as in the case of two known amino acid substitutions at position 7 of beta-globin. Finally, base substitutions in a protein coding region may mutate an amino acid codon to a termination codon or vice versa. The former type, which results in a prematurely shortened protein is referred to as a nonsense mutation. The effects of nonsense mutations are variable depending upon how much of the truncated protein is present and is required for its function.

Base substitution mutations may also occur in promoters or 5' regulatory regions of genes or in introns and may affect their transcription, translation, or splicing. Many of the beta-thalassemias are the result of these types of non-structural mutations that affect the level of expression of the globin genes. All of the types of mutation described above have been observed in human globin genes. Their consequences depend on what they do to the level of expression of the gene product and/or on what amino acid substitution may have occurred and where it is in the protein.

B. Frameshift mutations

These result from the insertion or deletion of one or more (not in multiples of three) nucleotides in the coding region of a gene. This causes an alteration of the reading frame: since codons are groups of three nucleotides, there are three possible reading frames for each gene although only one is used.

eg. mRNA with sequence AUG CAG AUA AAC GCU GCA UAA

amino acid sequence from the first reading frame: met gln ile asn ala ala stop

the second reading frame gives: cys arg stop

A mutation of this sort changes all the amino acids downstream and is very likely to create a nonfunctional product since it may differ greatly from the normal protein. Further, reading frames other than the correct one often contain stop codons which will truncate the mutant protein prematurely.

III. Origins of spontaneous mutation

A. Definition and sources

A spontaneous mutation is one that occurs as a result of natural processes in cells. We can distinguish these from induced mutations; those that occur as a result of interaction of DNA with an outside agent or mutagen. Since some of the same mechanisms are involved in producing spontaneous and induced mutations, we will consider them together. Some so-called "spontaneous mutations" probably are the result of naturally occurring mutagens in the environment; nevertheless there are others that definitely arise spontaneously, for example, DNA replication errors.

B. DNA replication errors and polymerase accuracy

Mistakes in DNA replication where an incorrect nucleotide is added will lead to a mutation in the next round of DNA replication of the strand with the incorrect nucleotide.The frequency at which a DNA polymerase makes mistakes (inserts an incorrect base) will influence the spontaneous mutation frequency and it has been observed that different polymerases vary in their accuracy. One major factor affecting polymerase accuracy is the presence of a "proofreading" 3'-5' exonuclease which will remove incorrectly paired bases inserted by the polymerase. This was shown in vitro with purified DNA polymerases (those with 3'-5' exonucleases make fewer mistakes) and genetically by Drake with bacteriophage T4 mutants: T4 has its own polymerase with a 3'-5' exo. Drake isolated mutator mutants (which had a higher spontaneous mutation rate than normal) and antimutator mutants (lower mutation rate than normal) in the polymerase gene and showed that the mutators had a higher ratio of polymerizing to exonuclease activity than normal and that the antimutators had a lower ratio. These studies showed that the function of the 3'-5' exonuclease is to prevent misincorporation during DNA replication and to prevent mutations. Mutator mutants have since been isolated in other organisms and have been shown to affect various components of the DNA replication complex; alterations in a number of these proteins are likely to affect the accuracy of the system.

C. Base alterations and base damage

The bases of DNA are subject to spontaneous structural alterations called tautomerization: they are capable of existing in two forms between which they interconvert. For example, guanine can exist in keto or enol forms. The keto form is favored but the enol form can occur by shifting a proton and some electrons; these forms are called tautomers or structural isomers. The various tautomer forms of the bases have different pairing properties. Thymine can also have an enol form; adenine and cytosine exist in amino or imino forms. If during DNA replication, G is in the enol form, the polymerase will add a T across from it instead of the normal C because the base pairing rules are changed (not a polymerase error). The result is a G:C to A:T transition; tautomerization causes transition mutations only.

Another mutatgenic process occurring in cells is spontaneous base degradation. The deamination of cytosine to uracil happens at a significant rate in cells.

Deamination can be repaired by a specific repair process which detects uracil, not normally present in DNA; otherwise the U will cause A to be inserted opposite it and cause a C:G to T:A transition when the DNA is replicated.

Deamination of methylcytosine to thymine can also occur. Methylcytosine occurs in the human genome at the sequence 5'CpG3', which is normally avoided in the coding regions of genes. If the meC is deaminated to T, there is no repair system which can recognize and remove it (because T is a normal base in DNA). This means that wherever CpG occurs in genes it is a "hot spot" for mutation. Such a hot spot has recently been found in the achondroplasia gene.

A third type of spontaneous DNA damage that occurs frequently is damage to the bases by free radicals of oxygen. These arise in cells as a result of oxidative metabolism and also are formed by physical agents such as radiation. An important oxidation product is 8-hydroxyguanine, which mispairs with adenine, resulting in G:C to T:A transversions.

Still another type of spontaneous DNA damage is alkylation, the addition of alkyl (methyl, ethyl, occasionally propyl) groups to the bases or backbone of DNA. Alkylation can occur through reaction of compounds such as S-adenosyl methionine with DNA. Alkylated bases may be subject to spontaneous breakdown or mispairing.

D. Spontaneous frameshift mutations

Streisinger observed in the 1960's that frameshift mutations in bacteriophages tended to occur in areas with "runs" of repeats of one nucleotide.

Example:

5' AGTCAATCCATGAAAAAATCAG 3'

3' TCAGTTAGGTACTTTTTTAGTC 5'

He proposed that these frameshifts are the result of "slipped mispairing" between the template DNA strand and the newly synthesized strand during DNA replication. In the sequence above, a likely spot for frameshift mutations to occur would be in the stretch of 6 A:T base pairs. Subsequent studies with genes from other organisms, including humans, have shown that runs of repeated nucleotides are indeed hotspots for frameshift mutations.

IV. Mutagens

A mutagen is a natural or human-made agent (physical or chemical) which can alter the structure or sequence of DNA.

A. Chemical mutagens

The first report of mutagenic action of a chemical was in 1942 by Charlotte Auerbach, who showed that nitrogen mustard (component of poisonous mustard gas used in World Wars I and II) could cause mutations in cells. Since that time, many other mutagenic chemicals have been identified and there is a huge industry and government bureaucracy dedicated to finding them in food additives, industrial wastes, etc.

It is possible to distinguish chemical mutagens by their modes of action; some of these cause mutations by mechanisms similar to those which arise spontaneously while others are more like radiation (to be considered next) in their effects.

1. Base analogs

These chemicals structurally resemble purines and pyrimidines and may be incorporated into DNA in place of the normal bases during DNA replication:

bromouracil (BU)--artificially created compound extensively used in research. Resembles thymine (has Br atom instead of methyl group) and will be incorporated into DNA and pair with A like thymine. It has a higher likelihood for tautomerization to the enol form (BU*)

aminopurine --adenine analog which can pair with T or (less well) with C; causes A:T to G:C or G:C to A:T transitions. Base analogs cause transitions, as do spontaneous tautomerization events.

2. Chemicals which alter structure and pairing properties of bases

There are many such mutagens; some well-known examples are:

nitrous acid--formed by digestion of nitrites (preservatives) in foods. It causes C to U, meC to T, and A to hypoxanthine deaminations. [See above for the consequences of the first two events; hypoxanthine in DNA pairs with C and causes transitions. Deamination by nitrous acid, like spontaneous deamination, causes transitions.

nitrosoguanidine, methyl methanesulfonate, ethyl methanesulfonate--chemical mutagens that react with bases and add methyl or ethyl groups. Depending on the affected atom, the alkylated base may then degrade to yield a baseless site, which is mutagenic and recombinogenic, or mispair to result in mutations upon DNA replication.

3. Intercalating agents

acridine orange, proflavin, ethidium bromide (used in labs as dyes and mutagens)

All are flat, multiple ring molecules which interact with bases of DNA and insert between them. This insertion causes a "stretching" of the DNA duplex and the DNA polymerase is "fooled" into inserting an extra base opposite an intercalated molecule. The result is that intercalating agents cause frameshifts.

4. Agents altering DNA structure

We are using this as a "catch-all" category which includes a variety of different kinds of agents. These may be:

--large molecules which bind to bases in DNA and cause them to be noncoding--we refer to these as "bulky" lesions (eg. NAAAF)

--agents causing intra- and inter-strand crosslinks (eg. psoralens--found in some vegetables and used in treatments of some skin conditions)

--chemicals causing DNA strand breaks (eg. peroxides)

What these agents have in common is that they probably cause mutations not directly but by induction of mutagenic repair processes (to be described later).

chemical mutagens

http://www.bact.wisc.edu/MicrotextBook/BactGenetics/chemmutagens.html

university of Wisconsin-Madison

Chemical mutagens

©2000 written by Gary Roberts, edited by Timothy Paustian, University of Wisconins-Madison

III B. CHEMICAL MUTAGENS

Chemical mutagens are defined as those compounds that increase the frequency of some types of mutations. They vary in their potency since this term reflects their ability to enter the cell, their reactivity with DNA, their general toxicity, and the likelihood that the type of chemical change they introduce into the DNA will be corrected by a repair system (section IIIC). The concerns in the use of mutagens are discussed in sections IIIF and G. Most of the following mutagens are used in vivo treatments, but some of them can also be used in vitro.

While the section below provides models for the molecular basis of many of these mutagens, it is exceedingly difficult to examine the actual mode of mutagenesis in vivo, because you are necessarily examining very rare events. Even if you can verify that a particular modified base can be formed in vitro by reaction with a mutagen, and that the modified base can give rise to a stable mutation in vivo, it cannot be assumed that this is the pathway for mutagenesis for the majority of the observed in vivo events.

III B1. BASE ANALOG MUTAGENS

Base analog mutagens are chemicals that look like normal bases and as such fool the DNA replication system. Their essential property is that they base-pair with two different bases thus making mutations because of their lack of consistency in base-pairing. To be mutagens they must be incorporated into the DNA and therefore they need be present during active DNA synthesis. An example is 5-bromo-deoxyuridine (5BU), which can exist in two tautomeric forms: typically it exists in a keto form (T mimic) that pairs with A, but it can also exist in an enol form (C mimic) that pairs with G.

Each of these chemicals will continue to mutagenize with time because of their constant likelihood of mispairing. By the same argument, it requires subsequent rounds of replication for any mutation to be generated since this requires "mispairing" during replication. Further, it takes another round of replication before the mutation is stabilized, that is, before both strands of DNA have the "mutant information". Until that occurs, the mismatch repair system can still recognize and remove the inappropriate base. This is termed "mutation fixation" and explains why these mutagens must be present during active DNA replication.

III B2. ALKYLATORS

These chemicals react directly with certain bases and thus do not require active DNA synthesis in order to act but still do require DNA synthesis in order to be "fixed". They are very commonly used because they are powerful mutagens in nearly every biological system. Examples of alkylators include ethyl methane sulfonate (EMS), methyl methane sulfonate (MMS), diethylsulfate (DES), and nitrosoguanidine (NTG, NG, MNNG) as shown in figure 8. These mutagens tend to prefer G-rich regions, reacting to form a variety of modified G residues, the result often being depurination. Some of these modified G residues have the property of inducing error-prone repair (see sec. III C) although mispairing of the altered base might also be possible. This stimulation of error-prone repair allows all sorts of mutation types to occur as a result of these mutagens, though base substitutions are by far the most frequent. It also appears that alkylated bases can mispair during replication. The relative contribution of all of these mechanisms to actual mutagenesis is unclear.

III B3. OTHER CHEMICAL MUTAGENS

Nitrous acid is another chemical mutagen that causes oxidative deamination of particular bases. It converts adenine to hypoxanthine (which now pairs with C), cytosine to uracil (which now pairs with A) and finally guanine to xanthine (which still continues to pair with C). Unlike the above mutagens, nitrous acid alters a base directly to a "miscoding" form and thus does not require subsequent DNA synthesis for its effect.

Yet another class of chemical mutagens, the so-called "ICR" compounds, induce frameshift mutations and these will be treated in the section on frameshift mutations. Some are depicted in figure 9 and these require DNA synthesis in order to cause mutations. They apparently mutagenize by "intercalating" between adjacent bases, perhaps making synthesis/repair systems think there is another base at that position.

Chemical Mutagens

The first report of mutagenic action by a chemical was in 1942 by Charlotte Auerbach, who demonstrated that nitrogen mustard could cause mutations in cells. Since then many other mutagens have been identified. Mutagens can be categorized by their modes of action, which are described below.

• Base Analogs

o Bromouracil: this compound resembles thymine and pairs with adenine. It has a higher likelihood of tautomerization than thymine and is commonly used in research

o Aminopurine: adenine analog which can pair with either T or C

• Chemicals which alter strucutre and pairing properties of bases

o Nitrous acid: Increases the frequency of spontaneous deaminations

o Alkylation: Several compounds such as nitrosoguanidine and methyl methanesulfonate can attach alykyl groups to bases, causing them to degrade or mispair

• Intercalating agents

o Acridine orange, proflavin, ethidium bromide, et.al: Flat aromatic ring structures that slide between the bases of DNA. This causes a structural conformation of the DNA duplex which confuses the polymerase causing it to add an extra basepair opposite the intercalating agent.

• Other

o Bulky Lesions: Large molecules which bind DNA and block the progress of polymerases

o Crosslinks: Compounds such as psoralens can cause inter and intra chain crosslinks in DNA

o Strand cleavage: Compounds such as peroxide can break DNA strands

http://www.sus.mcgill.ca/bio202/00b/lec21/sld002.htm

chemical mutagens

McGill University

Alkylating agents (transitions, transversions, framehifts, chromosomal, aberrations)

Base analogs (transitions)

Acridines (frameshift)

Deaminating agents (transitions)

Hydroxylamine (GC>AT transitions)

http://student.ccbc.cc.md.us/biotutorials/protsyn/mutate.html

Mutation

Results of mutation

One of four things can happen as a result of these mechanisms of mutation and the resulting change in the deoxyribonucleotide base sequence mentioned above:

a. A missense mutation (def) occurs. This is usually seen with a single substitution mutation and results in one wrong codon (def) and one wrong amino acid (see Fig. 20).

b. A nonsense mutation occurs (def). If the change in the deoxyribonucleotide base sequence results in transcription (def) of a stop or nonsense codon (def), the protein would be terminated at that point in the message (see Fig. 21).

c. A sense mutation (def) occurs. This is sometimes seen with a single substitution mutation when the change in the DNA base sequence results in a new codon still coding for the same amino acid (see Fig. 22). (With the exception of methionine, all amino acids are coded for by more than one codon.)

d. A frameshift mutation occurs (def). This is seen when a number of DNA nucleotides not divisible by three is added or deleted. Remember, the genetic code is a triplet code where three consecutive nucleotides code for a specific amino acid. This causes a reading frame shift and all of the codons and all of the amino acids after that mutation are usually wrong (see Fig. 23); frequently one of the wrong codons turns out to be a stop or nonsense codon and the protein is terminated at that point.

B. Induced Mutation (def) is caused by mutagens, substances that cause a much higher rate of mutation.

Chemical mutagens generally work in one of three ways.

Some chemical mutagens, such as nitrous acid and nitrosoguanidine, work by causing chemical modifications of purine and pyrimidine bases that alter their hydrogen-bonding properties. For example, nitrous acid converts cytosine to uracil which then forms hydrogen bonds with adenine rather than guanine.

Other chemical mutagens function as base analogs. They are compounds that chemically resemble a nucleotide base closely enough that during DNA replication, they can be incorporated into the DNA in place of the natural base. Examples include 2-amino purine, a compound that resembles adenine, and 5-bromouracil, a compound that resembles thymine. The base analogs, however, do not have the hydrogen-bonding properties of the natural base.

Still other chemical mutagens function as intercalating agents. Intercalating agents are planar three-ringed molecules that are about the same size as a nucleotide base pair. During DNA replication, these compounds can insert or intercalate between adjacent base pairs thus pushing the nucleotides far enough apart that an extra nucleotide is often added to the growing chain during DNA replication. An example is ethidium bromide.

Please be aware that the free essay that you were just reading was not written by us. This essay, and all of the others available to view on the website, were provided to us by students in exchange for services that we offer. This relationship helps our students to get an even better deal while also contributing to the biggest free essay resource in the UK!