Transcript profile of selected genes

Transcript profile of selected genes

5. Transcript profile of selected genes

5.1. Introduction

Plants are subjected to a variety of abiotic & biotic stresses such as salinity, flooding, mechanical stress, drought, thermal stress, attack by insects, wounds inflicted by phytophages, and infection by pathogens. These environmental stress factors influence crop growth and play a major limit on plant productivity. To overcome these limitations and improve crop yield under stress conditions, it is important to improve stress tolerance in crops. The responses of plants to various abiotic stresses have been important subjects of physiological studies and more recently molecular and transgenic studies (Rabbani et al., 2003). The identification of novel genes, determination of their expression patterns in response to the stress, and understanding of their functions in stress adaptation will provide us the basis of effective engineering strategies to improve stress tolerance (Cushman and Bohnert, 2000). A number of genes have been reported to be induced by drought, high-salinity, low-temperature and submergence stresses, and their products are thought to function in stress tolerance and response (Shinozaki and Yamaguchi Shinozaki, 2000). Many stress-inducible genes are responsive to both water stress and low temperature. Some of these genes are induced only by water stress, and several genes respond only to low temperature. Analysis of these stress-inducible genes indicate the existence of complex regulatory mechanisms between perception of abiotic stress signals and gene expression (Shinozaki and Yamaguchi-Shinozaki, 2000; Zhu, 2002).

Plant science has entered a new era after the completion of the entire genomic sequence of rice, representing model system for monocot plants. Rice, the most important world food crop, has now emerged as a model crop plant for genome analysis due to its relatively small genome size (approximately 430Mb). Abiotic stresses decrease rice yields by about 15% in Asia, more than twice the damage caused by biotic stress (Dey & Upadhaya, 1996). Higher plants are aerobic organisms occasionally experience a lower oxygen availability (hypoxia) and less frequently, total absence of oxygen (anoxia) resulting from environmental factors (flooding of the soil). Gene expression is strongly altered by anoxia and protein synthesis is redirected to the production of a new set of polypeptides (ANP's, anaerobic polypeptides or ASP's, anaerobic stress proteins, Geigenberger, 2003). Rice cultivars differ with the energy supply, which is indeed a key factor for tolerance to oxygen deficiency (Atwell et al., 1982; Setter et al., 1994).

Plants are sensitive to gaseous exchange and can die upon limited supply of oxygen which occurs due to soil flooding, since gases diffuse at the slower rate in water. (Voesenek et al., 2006). Some semi-aquatic species are able to withstand submergence by adapting dual strategies to elude or confront flooding from few days to weeks. A well known example is rice that not only has the potential to withstand but also grow vigorously and produce seeds in flooded soil conditions. Plants tolerating submergence possess characteristic morphological and metabolic features. They have the ability to generate ATP in the absence of oxygen (fermentative metabolism) and or to develop distinct morphology (such as Air channels, enhanced shoot elongation) that enables the access of the plants to the better aerated atmosphere for oxygen entry (Jackson, 1985; Crawford, 1992; Perata and Alpi, 1993; Armstrong et al., 1994; Drew et al., 2000; Sauter, 2000; Colmer, 2003; Gibbs &Greenway, 2003; Voesenek et al., 2006).

Plants exposed to low oxygen exhibit the up regulation of genes coding for transcription factors (Hoeren et al., 1998; Liu et al., 2005), ethylene biosynthesis (Vriezen et al., 1999) and cell wall loosening (Saab & Sachs, 1996). Under low oxygen anaerobic protein synthesis is induced, most of which are enzymes involved in carbohydrate metabolism, (Sachs et al., 1980; Huang et al., 2005). Despite knowledge on plants adaptations and gene regulation, understanding the plant response mechanism to anaerobiosis is very limited. The response to flooding in plants is far more complex mechanism than anticipated. Molecular mechanisms involving rice coleoptile elongation under submergence, which is not seen in other cereal is poorly understood.

5.2. Seed germination under anoxia

Germination is the first stage of the life cycle in plants. Seed germination is a complex phenomenon influenced by many genes and environmental conditions. Germination rate and early seedling growth are major components of seedling vigor. Good seedling vigor is important objective under direct-seeding cultivation. Seed germination and seedling growth depends on the enzymatic hydrolysis of the starchy endosperm. Investigation of gene expression in the germination stage may provide information for understanding mechanism of seedling development.

Rice seeds can germinate under wide range of environmental conditions in particular with hypoxia or anoxia, experienced during direct sowing as a consequence of soil flooding (Yamauchi et al., 2000). One of the major abiotic constraints on production is soil flooding, with complete submergence being a major factor in the rainfed lowlands of humid and semi-humid tropics of Asia (Jackson & Ram, 2003).

Research into rice adaption to anoxia has reached a new level after the biochemical characterization of anoxic rice germination by Alpi and Beevers in 1983. A detailed research into those lines depicting a characteristic phenotype in terms of anoxic germination might reveal some molecular mechanisms that allow germination and coleoptile elongation in rice under complete anoxia. However, understanding the oxygen-sensing mechanisms function remains a unique challenge. The genes that code for enzymes that are active only in presence of oxygen for their activity are dramatically down-regulated under anoxia, reveal an escape strategy intend to save energy by preventing the production of enzymes that would not be operative under anoxia, thus saving energy involving expression of genes required for the rice seedling adaption.

Rice coleoptile elongation under submergence is well understood, however the mechanisms involving and gene involved in adaptation have recently been discovered (Fukao et al., 2006; Xu et al., 2006). Switch over from aerobic to anaerobic fermentation results in down regulation of sugar transporters under anoxia and the coleoptiles undergo sugar starvation (Alpi and Beevers, 1983). Sugar starvation represents a signal for genes involved in anaerobic metabolism like Hexokinase (Fox et al., 1998). Thus, sugars may denote as a vital secondary messengers in low-oxygen signaling.

5.3. Seedling establishment

The existing cultivars are not well adapted for early seedling growth in an oxygen deficit environment. Low oxygen environment severely restricts the root and leaf growth of seedlings while allowing the coleoptile and mesocotyl of the shoot to grow. Genotypes vary in sensitivity to oxygen deprivation (Yamauchi et al., 1993; Tuner et al., 1981). Root growth is inhibited in seeds germinated under water until shoots are produced, thereby providing an energy conserving mechanism during early stages when oxygen is limited (Cobb & Kennedy, 1987). This is an avoidance strategy & allows initial seedling establishment by initiation of mesocotyl and first leaf then by root growth and development.

Strong seedling vigor under low temperature is an important objective of rice breeding programs in direct seeding cultivation methods in temperate rice growing areas, at high altitudes in tropical and subtropical areas, and in areas with a cold irrigation water supply where low temperature induces retardation of early seedling growth.

Many metabolic changes occur during germination and early growth under anaerobic conditions (Kato-Noguchi, 2006; Lasanthi-Kudahettige et al., 2007; Mustroph et al., 2006). Ethanol fermentation is important for hypoxia or anoxia tolerance as reported by Jacobs et al., 1988. There are many reports of changes in gene transcription consequent upon different environments, with some transcripts exhibiting strong down-regulation while others increase. Lasanthi-Kudahettige et al., 2007 also reported a strong down regulation of a catalase (Os02g2400) in anoxic coleoptiles. These genes are involved in basic metabolism and can be categorized as follows:

5.4. IDENTIFICATION OF TARGET GENES

Several proteins with increased abundance under low oxygen were subsequently identified as enzymes involved in the breakdown of sucrose, glycolysis & fermentation (Subbaiah and Sachs, 2003). Not only the fermentative pathway is enhanced under low oxygen but also the xyloglucan endotransglycosylase gene (Peschke & Sachs, 1994) suggesting that the anaerobic response is far from being a simple switch from aerobic respiration to fermentative metabolism.

5.4.1. Carbohydrate metabolism

In cereals, seed germination and early seedling growth are dependent upon the enzymatic hydrolysis of the starchy endosperm into metabolizable sugars (Huang et al., 1990). Complete hydrolysis of starch is considered to result from the concerted action of four enzymes, namely α-amylase, β-amylase, debranching enzyme, and α-glucosidase (Sun and Henson, 1991). It has been suggested that α-amylase plays a major role during the starch degradation at the germination stage because the enzyme constituted about 40-60% of the de novo protein synthesis in grains, and is thought to be the only enzyme that can directly attack and hydrolyze the native starch granules (Mitsunaga et al., 2001) causing endoglycolytic cleavage of amylose and amylopectin (Akazawa and Hara-Nishimura, 1985).

Exceptionally, transcripts of rice α-amylases accumulate in the seed embryo and aleurone during germination, even under anoxia (Hwang et al., 1999). In addition, as the process of germination proceeded, α-amylase protein levels and activity were shown to be induced by anoxia in rice seedlings until 6 days after sowing (Guglielminetti et al., 1995). Semi quantitative RT-PCR detection of the transcripts of three α-amylase genes, Rice Amylase-3C (RAmy3C), RAmy3D, and RAmy3E, revealed that their upregulation was controlled by the Sub1 locus. The level of RAmy3C mRNA increased immediately under submergence stress, reached a maximum by day 6, and then decreased through day 14 in both tolerant and intolerant genotypes (Fukao et al., 2006). Overall, RAmy3C transcript induction was greater in intolerant cultivars. RAmy3D and RAmy3E transcript increases occurred later than RAmy3C. RAmy3C and RAmy3D mRNA accumulation was responsive to ethylene at similar levels, whereas RAmy3E transcript abundance was not affected by ethylene. Hypoxia delayed the expression of RAmy3D and anoxia affects the gene expression. Anoxia induced α-amylase isoform encoded by RAmy3D gene correlated with coleoptile elongation in submerged conditions, but the expression was repressed by the presence of sugar and promoted by sugar starvation. The repression of RAmy3D expression at an early germination stage resulted from the failure of the seeds to germinate in submerged soil. The synthesis of the RAmy3D encoded isoforms in anoxia is principally regulated at the post-transcriptional level at the early stage of germination. The gene expression is regulated by oxygen level and is tissue specific (Huang et al., 2000).

On the other hand, under anaerobic conditions, the elongation of the coleoptiles is efficient, unlike that of the leaves and roots (Saika et al., 2006). Alcoholic fermentation fuels anaerobic growth and occurs in two reaction steps: the decarboxylation of pyruvate to acetaldehyde by pyruvate decarboxylase (PDC) and the subsequent reduction of acetaldehyde to ethanol by alcohol dehydrogenase (ADH). This metabolic pathway supports glycolysis and ATP synthesis by recycling NAD+. Analyses of ADH- deficient mutants have shown that ADH is required for anaerobic tolerance in rice (Matsumura et al 1998).

In most of the grasses including rice genome, at least two ADH genes are present (ADh3 and ADh3) that display different patterns of expression (Gaut et al., 1999 and Lasanthi-Kudahettige et al., 2007).When rice germinates under water, ADH activity is required for coleoptile elongation (Setter and Ella 1994, Kato-Noguchi 2001, Kato-Noguchi and Kugimiya 2003). Accumulation of Adh3 and Adh3 mRNA occurred within 1 day of submergence, and remained steady through day 14 (Fukao et al., 2006). ADH enzyme activity increased continuously for 14 d of submergence, although the rate of increase was gradually lessened. Anoxic rice coleoptiles show intense expression of alcohol dehydrogenase (ADH) genes and distinct expression of ADh3 and ADh3, the latter being induced at a higher level.

Lasanthi-Kudahettige et al., 2007 reported a strong up regulation of genes involved in pyruvate metabolism. Anoxic conditions highly induce the transcript encoding phosphoenolpyruvate (PEP) carboxykinase (PCK), pyruvate orthophosphate dikinase (PPDK) and pyruvate decarboxylase (PDC) genes while repressing the activity of PEP carboxylase (PEPC). Aerobic coleoptiles show high levels of PEPC, which deprives PEP from glycolysis which if not down regulated would compete with PCK, that is absent under aerobic condition whilst strongly expressed under anoxia. PCK role in the anaerobic metabolism is unclear, but may have a role to channel amino acids through oxaloacetate into glycolysis through a cataplerotic reaction (Owen, 2002). Hexokinase catalyses the production of hexose-6-phosphate from hexoses such as glucose or fructose and shows enhanced expression under anoxia (Guglielminetti et al., 1995). Lasanthi-Kudahettige et al., 2007 showed that only OsHXK7 (Os05g09500) is up-regulated in anoxic rice coleoptiles four days after germination, resulting from sugar starvation, since this hexokinase gene was shown to be a sugar-repressed (Cho et al.,2006).

Several genes coding enzymes involve in glycolysis show enhanced mRNA accumulation proving the previous research results from enzymatic arrays (Guglielminetti et al., 1995). OsHXK7 is a starvation-induced gene (Cho et al., 2006) and anoxic coleoptiles are low in sugar as a consequence results in its high induction (Alpi & Beevers, 1983). Lack of sugar supply to the growing coleoptile explains the sugar starvation (Alpi and Beevers, 1983) despite the availability of products in the endosperm (Perata et al., 1992). Translocation of glucose-6-phosphate to the amyloplasts and sucrose breakdown in the vacuole is repressed.

Anoxic conditions reveal significant modulation of only RAmy3D α-amylase gene (Huang et al., 1990). Anoxic coleoptiles expression pattern show enhanced expression of RAmy3D gene compared to aerobic coleoptiles. RAmy3D is known to be a starvation-induced gene (Yu et al., 1996; Loreti et al., 2003). Anoxic germination shows a rapid degradation of starch, indicating that the expression of RAmy3D has relevant consequences on starch metabolism whilst the aerobic coleoptiles are high in sucrose and fructose levels. Sugar starving anoxic coleoptiles may indirectly induce RAmy3D, suggesting sugars acting as a signal molecule to activate the pathway triggering induction of genes such as RAmy3D.

Target gene of interest: Submergence promotes increase in RAmy3D, which was considerably more pronounced in the intolerant cultivars. ADh3 and ADh3 are expressed in roots under anoxic conditions and are required for growth. ADH activity is required for the coleoptile elongation under submerged conditions. Anoxia induces high induction of PCK while represses PEPC and HXK7.

5.4.2. Cell expansion

Expansins play a key role in the anoxic coleoptile elongation due to cell expansion (Cosgrove, 1999; Huang et al., 2000). Expansins are proteins that mediate long-term extension of isolated cell walls. Expression of two α-expansin genes, Os-EXP2, and Os EXP4, is induced by submergence (Cho & Kende, 1997). EXPA7, EXPB12, EXPA2 and EXPA4 are identified as candidate genes involved in elongation of the anoxic coleoptile (Huang et al., 2000), provides the basis for future investigations and the study of germplasm showing a distinct ability to elongate the coleoptile under anoxia.

Expansins are plant cell wall loosening proteins involved in cell enlargement and in a variety of other developmental processes in which cell wall modification occurs (Cosgrove, 2000). The lack of enzyme activity, and owing to their reversible action on cell wall extensibility, expansins are assumed to disrupt hydrogen bonds between polysaccharides in cell walls strained mechanically by turgor pressure. A new hypothesis has been proposed according to which the enlarging distance between microfibrils is the main factor responsible for the increase in extensibility of cell walls (Thompson, 2005).

They are typically 250-275 amino acids long and are made up of two domains preceded by a signal peptide. The N-terminal signaling peptide (20-30 amino acid residues) ensures the targeting of proteins into the lumen of the endoplasmic reticulum. Domain 1 is adjacent to the signaling peptide, is composed of 120-135 amino acid residues and includes a series of conserved cysteine residues (eight in EXPA and six in EXPB), a conserved motif His-Phe-Asp, as well as a small alkaline region enriched with Lys and Arg residues. The C-terminal domain 2 comprises 90-120 amino acid residues and is characterized by the presence of four conserved tryptophan residues.

Expansins are divided in four families: α-expansins (EXPA), β-expansins (EXPB), expansin-like A (EXLA), and expansin-like B. (EXLB) (Sharova, 2007). EXPBs modify type-II cell walls, rich in arabinoxylans and β-glucans, characteristic of grasses. Expansin-like A (EXLA) and expansin-like B (EXLB) proteins are known only from their gene sequences. Each plant contains numerous genes coding for expansins. The number of expansin genes indicates that expression of individual expansin genes which may be differentially regulated depending on developmental stages and environment. Changes in expansin activity usually correlate with changes in the respective mRNA content. Thus, expansin activity is mainly determined by transcription, which in turn is finely regulated by phytohormones (Cho and Cosgrove, 2004) and environmental conditions (Sharova, 2007).

The rice genome contains 58 expansin genes: 34 EXPA, 19 EXPB, 4 EXLA, and 1 EXLB (Sampedro and Cosgrove, 2005). Expansin genes are differentially expressed in the major vegetative parts of rice plants, and their mRNAs are most abundant in actively growing organs, such as the coleoptile and the primary root. Highly localized occurance of expansin protein along the inner epidermal layer and around immature vascular bundles of rice internodes has been reported (Cho and Kende, 1997). At least seven Expansin A (EXPA) mRNAs accumulate in leaves of deepwater japonica rice, and their abundance was upregulated by submergence of 3 day old seedlings (Lee and Kende, 2002). The levels of five EXPA transcripts , EXPA1, EXPA5, EXPA6, EXPA7, and EXPA16, were assessed by semi quantitative RT-PCR analysis in the two near-isogenic lines. The expression of these expansins increased gradually over 14 d of submergence in a submergence intolerant cultivar whilst in the tolerant cultivar one of these transcripts increased slightly until day 3 or 6 and then declined. A higher and more sustained accumulation of EXPA mRNAs during submergence was consistent with the significant promotion of leaf and internode elongation in the 28 days old submergence intolerant japonica cultivar (Fukao et al., 2006). This would allow the plant to adapt changes in environment.

The alpha expansin genes Os-EXP2 and Os-EXP1 were predominantly expressed in the developing seeds, mainly in newly developed leaves, coleoptiles, and seminal roots after germination. In coleoptiles, Os-EXP4 and Os-EXP2 mRNAs were greatly induced by submergence, while they were weakly detected in aerobic or anoxic conditions in 8-day-old seedlings of japonica (cv Nipponbare). Expansin gene expression is highly correlated with coleoptile elongation in response to oxygen concentrations (Huang et al., 2000). The Os-EXP4 gene was also expressed in leaves, mesocotyl and coleorhiza of young seedlings. The growth of these tissues was also correlated with the presence of expansins. Transcripts of Os-EXP1 and Os-EXP3 were almost undetectable in coleoptiles that had elongated under hypoxia, aerobic or anoxic conditions. Hypoxia greatly induced the expression of α-expansin genes Os-EXP4 and Os-EXP2 in the coleoptile, while there were fewer α-expansin transcripts in the air and anoxia-grown coleoptiles. On the other hand, when coleoptiles emerged from the water layer and subsequently entered the air, expression of Os-EXP4 and Os-EXP2 was soon suppressed, confirming the role of α-expansins in the elongation of submerged rice coleoptiles. In young japonica cv Nipponbare seedlings raised under aerobic conditions, the Os-EXP4 gene is obviously expressed in growing leaves and mesocotyl.

Target gene of interest: EXPA 2 and EXPA 4 were selected because the expression was induced by submergence. EXPA 2 was selected because it is predominantly expressed in newly developed leaves, coleoptiles and seminal roots. The expansins EXPA4, EXPA2, EXPA7 EXPB2, EXPB6, EXPB11, and EXPB12 were expressed as having a vital role under submergence in japonica variety, these were selected to explore the expression of these genes in the selected cultivars under the experimental conditions.

5.4.3. Reference genes

These genes are always expressed because they code for proteins that are constantly required by the cell. Hence, they are essential to a cell and are always present in the cell under any conditions. The proteins they code are generally involved in basic functions necessary for the sustenance of the cell. Ubiquitin is a small regulatory protein. Xylanase inhibitor protein (XIP) genes were strongly up-regulated under anoxia. XIPs are known to be induced as a defense mechanism resulting from pathogen infestation, as well as by wounding and methyl jasmonate (Igawa et al., 2005). XIP's may be induced in the seedlings under anoxia to enhance protection of the seedling from pathogen infection in the moist environment of flooded soil.

Target gene of interest: Anoxia up-regulates the induction of XIP, while ubiquitin is house-keeping gene which is not influenced by anoxia.

Primer pairs were designed to amplify a portion of the coding region of selected genes, which were selected as candidates as tools to assess their expression under experimental environments in which the rice seedlings were treated. Ubiquitin and XIP's gene transcripts were selected as a reference.

5.5. Identification of selected genes of interest

Seeds were grown and plant material was extracted as mentioned earlier (Section 3.1). Extraction and purification of the genomic DNA and RNA was carried out accordingly (Section 3.2). PCR amplification and identification of the presence of the genes of interest was done as mentioned earlier (Section 3.5). The PCR products were confirmed after cloning and sequenced (Section 3.6).

5.5.1. Results

The PCR studies indicate the presence of the target genes in the selected cultivars.

Fig Genomic DNA studies showing the presence of the target genes of interest using 10 days old shoots of CV (A)Azucena showing the presence of alcohol dehydrogenase genes 1 ADh3, 2 ADh3, the α-amylase gene 3 RAMY3D, and the Expansin genes 4 EXPA2. 5 EXPA4. 6EXPA7. 7 EXPB6. 8 EXPB11. 9 EXPB12. 10 UQ52. Hyperladder IV (100-1000 bp) in the first and last well.

PCR studies revealed the presence of the genes of interest in the other three cultivars. For EXPB12 expected band size is 241 bp but got a band of >400 bp with the genomic DNA.

Fig. Hyper ladder V in first and last well and primers 1. PCK, 2. XIP, 6. PEPC, 10. EXPA7, 11. ERF69 and 14. HXK7 respectively.

5.5.2. Transcript profile using RT-PCR probes:

Reverse transcription polymerase chain reaction (RT-PCR) is widely used in the determination of the abundance of specific RNA molecules within a tissue as a measure of gene expression. The RNA strand is first reverse transcribed into its complementary DNA, followed by amplification of the resulting DNA by PCR. RT-PCR provides a highly sensitive technique, where a very low copy number of RNA molecules can be detected.

Initial RT-PCR studies indicate the expression of the target genes in the 10 day old shoots of Azucena cultivar. The band size for EXPB12 is now 241 bp since the primers were designed across an intron, so giving a different sized band with genomic DNA but with cDNA the expected band was obtained.

5.5.3. Sequencing to confirm the identity of PCR fragments:

The amplification of the correct gene of interest was confirmed by obtaining its sequence following method described earlier (Section 3.6). Sequencing involves amplification of the DNA and cloning (insertion of DNA segment into the plasmid, insertion of the vector (plasmid+DNA) into the bacterial cells (E. coli) and overnight culture of the bacteria for amplification of the vector). The vector extracted from the selected colonies and some of it used for restriction digest to confirm the presence of the insert. The results were then checked on gel. Once the gene of interest was confirmed on the restriction digest gel, the DNA sample was sent to automated sequencing (John Innes genomic lab). The sequencing results obtained are then compared with the sequence data base for analysis. Three clones per each gene contributed for each gene.

5.5.4. Analysis of the sequenced fragments

The genomic sequences of the target genes with the primers (highlighted in red) designed obtained after cloning are as follows:

LOC_Os11g10480 sequence information

Alcohol dehydrogenase 1 putative expressed (ADh3)

Genomic sequence length: 2891 nucleotides

CDS length: 1140 nucleotides
Protein length: 379 amino acids

Forward primer: start 262 length 20 bp Tm 59.8

Reverse primer: start 440 length 20 bp Tm 59.9 Product size 179 bp

Score = 344 bits (179), Expect = 5e-91

Identities = 179/179 (100%), Gaps = 0/179 (0%) Strand=Plus/Minus

Seq GAAGTCCCGACGAAATGGTAAATGGGCTTCCCGTTGATGGAAAAGCGTGATTT

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA GAAGTCCCGACGAAATGGTAAATGGGCTTCCCGTTGATGGAAAAGCGTGATTT

Seq GCCATCACCAATCATCACACCCCTGTCAGTGTTGATCCTGAGCAGATCACACA

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA GCCATCACCAATCATCACACCCCTGTCAGTGTTGATCCTGAGCAGATCACACA

Seq TGTTGCTCTCTGCTGACTTGCAGTGGGCACACTCCTTGCACTCCCCAGTGAAC

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA TGTTGCTCTCTGCTGACTTGCAGTGGGCACACTCCTTGCACTCCCCAGTGAAC

Seq ACAGGGAGAACATGGTCACC

||||||||||||||||||||

cDNA ACAGGGAGAACATGGTCACC

LOC_Os11g10510 sequence information

Alcohol dehydrogenase 2 putative expressed (ADh3)

Genomic sequence length: 2630 nucleotides

CDS length: 1140 nucleotides
Protein length: 379 amino acids

Left primer: start 229 length 20 bp Tm 60.0

Right primer: start 443 length 20 bp Tm 60.0 Product size 215 bp

Score = 402 bits (209), Expect = 2e-108

Identities = 209/209 (100%), Gaps = 0/209 (0%)

Strand=Plus/Minus

Seq GTGGATGTGCCAACAAAGTGGAAGATGGGCTTCCCCTTGATGGTGAATCGGGAC

||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA GTGGATGTGCCAACAAAGTGGAAGATGGGCTTCCCCTTGATGGTGAATCGGGAC

Seq TTGCCGTCGCCGATCATGACGCCGCGGTCGACGTTGATCCTGAGGAGGTCACAC

||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA TTGCCGTCGCCGATCATGACGCCGCGGTCGACGTTGATCCTGAGGAGGTCACAC

Seq ATGTTGCTCTCCTCCGATTTGCAGTGATCACACTCCTTGCACTCGCCGGTGAAC

||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA ATGTTGCTCTCCTCCGATTTGCAGTGATCACACTCCTTGCACTCGCCGGTGAAC

Seq ACCGGGAGGACATGGTCGCCCGGCGCGAGTTCGGTCACACCCTCTCC

|||||||||||||||||||||||||||||||||||||||||||||||

cDNA ACCGGGAGGACATGGTCGCCCGGCGCGAGTTCGGTCACACCCTCTCC

LOC_Os08g36910 sequence information

Alpha-amylase isozyme

3D precursor putative expressed (RAMY3D)

Genomic sequence length: 1643 nucleotides

CDS length: 1431 nucleotides
Protein length: 476 amino acids

Left primer: start 1164 length 20 bp Tm 59.9

Right primer: start 1396 length 20 bp Tm 60.0 Product size 233 bp

Score = 442 bits (230), Expect = 1e-120

Identities = 232/233 (99%), Gaps = 0/233 (0%)

Strand=Plus/Minus

Seq CCTTCTCCCAGACGCTGTAGTCCTTGCCGTGCACCGTCTGATGGAAATCCGACGG

|||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CCTTCTCCCAGACGCTGTAGTCCTTGCCGTGCACCGTCTGATGGAAATCCGACGG

Seq CACCGCGTTGCCCACGTCGTACCTCGTCCCGATCTTCACCATGACCTTCTCGTCG

|||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CACCGCGTTGCCCACGTCGTACCTCGTCCCGATCTTCACCATGACCTTCTCGTCG

Seq ACGACGGCGACGTATGCGTCGGCGTCGGCGACAACGATCCGGAGCTTGCTCCCGG

|||||||||||||||||||||||||||||||| ||||||||||||||||||||||

cDNA ACGACGGCGACGTATGCGTCGGCGTCGGCGACGACGATCCGGAGCTTGCTCCCGG

Seq CGTTGATGCCGTTCCTCTCCCTGATCGCCGCCAGCGCGGTTATCTCCTGCTTCAG

|||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CGTTGATGCCGTTCCTCTCCCTGATCGCCGCCAGCGCGGTTATCTCCTGCTTCAG

Seq GTTCCAGTCGAAC

|||||||||||||

cDNA GTTCCAGTCGAAC

LOC_Os01g60770 sequence information

Alpha-expansin 2precursor putative expressed (EXPA 2)

Genomic sequence length: 1224 nucleotides

CDS length: 756 nucleotides
Protein length: 251 amino acids

Forward primer: start 475 length 20 bp Tm 60.7

Left primer: start 475 length 20 bp Tm 60.7

Right primer: start 643 length 20bp Tm 60.0 Product size 169 bp

Score = 325 bits (169), Expect = 3e-85

Identities = 169/169 (100%), Gaps = 0/169 (0%)

Strand=Plus/Minus

Seq CGTCGAGGTAGGAGTTGCTCTGCCAGTTCTGGCCCCAGTTGCGGGACATGGGCTG

|||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CGTCGAGGTAGGAGTTGCTCTGCCAGTTCTGGCCCCAGTTGCGGGACATGGGCTG

Seq CCACCCGGTGCTGGACCCCTTGATCGACACGGACTGCACGTCGCCTGGGCCGGCC

|||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CCACCCGGTGCTGGACCCCTTGATCGACACGGACTGCACGTCGCCTGGGCCGGCC

Seq ACGTTGGTCACAAGAACCAGGTTGAAGTAGGAGTGCCCGTTGATGGTGAACCTGA

|||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA ACGTTGGTCACAAGAACCAGGTTGAAGTAGGAGTGCCCGTTGATGGTGAACCTGA

Seq TCCC

||||

cDNA TCCC

LOC_Os05g39990 sequence information

Alpha-expansin 1 precursor putative expressed (EXPA4)

Genomic sequence length: 1351 nucleotides<

CDS length: 741 nucleotides
Protein length: 246 amino acids

Forward primer: start 13 length 20 bp Tm 60.0

Reverse primer: start 163 length 20 bp Tm 60.0 Product size 151 bp

Score = 279 bits (145), Expect = 2e-71

Identities = 149/151 (98%), Gaps = 0/151 (0%)

Strand=Plus/Minus

Seq ACCCTTGGCTGTACAGGTTGCCGTAACCGCAAGCCCCGCCCATGGTTCCGGAAG

|||||||||||||||||||||||||||||||||||||||||||||| |||||||

cDNA ACCCTTGGCTGTACAGGTTGCCGTAACCGCAAGCCCCGCCCATGGTGCCGGAAG

Seq CATCGCCGCCGCCGTAGAACGTGGCGTGGGCGCTCTGCCAACCGCCGTACCCGG

|||||||||||||||||||||||||||||||||||||||| |||||||||||||

cDNA CATCGCCGCCGCCGTAGAACGTGGCGTGGGCGCTCTGCCACCCGCCGTACCCGG

Seq CGGCGGAGGCTTGCCGTGCCAAGAAGAGGAGGAAGAGAACGCC

|||||||||||||||||||||||||||||||||||||||||||

cDNA CGGCGGAGGCTTGCCGTGCCAAGAAGAGGAGGAAGAGAACGCC

LOC_Os03g60720 sequence information

Alpha-Expansin 7(EXPA7)

Genomic sequence length: 2161 nucleotides

CDS length: 795 nucleotides
Protein length: 264 amino acids

Left primer: start 519 length 20 bp Tm 59.9

Right primer: start 674 length 19 bp Tm 59.7 Product size 156 bp

Score = 292 bits (156), Expect = 6e-83

Identities = 156/156 (100%), Gaps = 0/158 (0%) Strand=Plus/Minus

Seg ACGAGGACGGAGTTGGACTGCCAGTTCTGGCCCCAGTTCCGCGACATGGGCATCCACC

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA ACGAGGACGGAGTTGGACTGCCAGTTCTGGCCCCAGTTCCGCGACATGGGCATCCACC

Seg CGGTGCTCGTCCCCTTCACGCTCGCCCTCACGATGTCCCCGGCCCCGGCCACGTTCG

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CGGTGCTCGTCCCCTTCACGCTCGCCCTCACGATGTCCCCGGCCCCGGCCACGTTCG

Seg TGATCAGCACCAGGTTGAAGTACCTGAACCCGTTTATCGTG

|||||||||||||||||||||||||||||||||||||||||

cDNA TGATCAGCACCAGGTTGAAGTACCTGAACCCGTTTATCGTG

LOC_Os10g40710 sequence information

Beta-expansin 1a precursor putative expressed (EXPB2)

Genomic sequence length: 1246 nucleotides

CDS length: 786 nucleotides
Protein length: 261 amino acids

Forward primer: start 74 length 20 bp Tm 59.7

Reverse primer: start 275 length 20 bp Tm 60.0 Product size 202 bp

Score = 389 bits (202), Expect = 2e-104

Identities = 202/202 (100%), Gaps = 0/202 (0%) Strand=Plus/Minus

Seq TTGGTGCACCGTATCTGGTAGCAGGCGCCACAGCCCTTGCCGTCCTGGAACAG

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA TTGGTGCACCGTATCTGGTAGCAGGCGCCACAGCCCTTGCCGTCCTGGAACAG

Seq AGGCTCGTTGCCGCAGGAGGTCATGGACATGAACGGGTACTGGTTGGTGTTCT

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA AGGCTCGTTGCCGCAGGAGGTCATGGACATGAACGGGTACTGGTTGGTGTTCT

Seq TGAACCCGCACGCACCGCCGTTGTCGTCGGGTCCGGCGCCGTTGGGCTGGCCG

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA TGAACCCGCACGCACCGCCGTTGTCGTCGGGTCCGGCGCCGTTGGGCTGGCCG

Seq TACCAGGTGGCCTTGGCCGGGAGCCAGTCGTTGGTGTAGACGA

|||||||||||||||||||||||||||||||||||||||||||

cDNA TACCAGGTGGCCTTGGCCGGGAGCCAGTCGTTGGTGTAGACGA

LOC_Os10g40700 sequence information

Beta-expansin 1a precursor putative expressed (EXPB6)

Genomic sequence length: 1104 nucleotides

CDS length: 828 nucleotides
Protein length: 275 amino acids

Forward primer: start 298 length 20 bp Tm 59.8

Reverse primer: start 483 length 20 bp Tm 59.6 Product size 186 bp

Score = 342 bits (178), Expect = 2e-90

Identities = 185/186 (99%), Gaps = 1/186 (0%) Strand=Plus/Minus

Seq CCTGAACTGGTGTCGATGATGCCCGAGTGGCGGAGCTTGTCGTTGAGCCCCGG

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CCTGAACTGGATGTCGATGATGCCCGAGTGGCGGAGCTTGTCGTTGAGCCCCGG

Seq CTTGGCCATGGCGCCGAACGCCGTGCCGCTCAGGTCGAAGTGGTACCTGGCCAC

||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CTTGGCCATGGCGCCGAACGCCGTGCCGCTCAGGTCGAAGTGGTACCTGGCCAC

Seq GGGGTAGTAGTTCATGTCGGTGATGATCACCGTCTCGATGTTGCCCGAGCACGA

||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA GGGGTAGTAGTTCATGTCGGTGATGATCACCGTCTCGATGTTGCCCGAGCACGA

Seq CGGGTCCTTGTTGCACCTGATCTG

||||||||||||||||||||||||

cDNA CGGGTCCTTGTTGCACCTGATCTG

LOC_Os02g44108 sequence information

Beta-expansin 4 precursor putative expressed (EXPB11)

Genomic sequence length: 1247 nucleotides

CDS length: 879 nucleotides
Protein length: 292 amino acids

Forward primer: start 354 length 20 bp Tm 60.1

Reverse primer: start 559 length 20 bp Tm 60.0 Product size 206 bp

Score = 396 bits (206), Expect = 1e-106

Identities = 206/206 (100%), Gaps = 0/206 (0%) Strand=Plus/Minus

Seq ATGGCACCCTTCTGTACTGGACCTGGAGGATACCGGCGGCGCGGAGCTTGTCG

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA ATGGCACCCTTCTGTACTGGACCTGGAGGATACCGGCGGCGCGGAGCTTGTCG

Seq GCCATGCCGGGCTTGGCCATGGCGCCCATGGAAGTGCCGCTCATGTCGAAGTG

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA GCCATGCCGGGCTTGGCCATGGCGCCCATGGAAGTGCCGCTCATGTCGAAGTG

Seq CGCGGCGCCGGCGAGGCAGATGCCCCCGGGGCACTCGTCGGTGATGACGACGG

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CGCGGCGCCGGCGAGGCAGATGCCCCCGGGGCACTCGTCGGTGATGACGACGG

Seq TGGCTGGCTGGCCGGAGCAAGCTGCGTTGGTCGTGCATTTAACCTCA

|||||||||||||||||||||||||||||||||||||||||||||||

cDNA TGGCTGGCTGGCCGGAGCAAGCTGCGTTGGTCGTGCATTTAACCTCA

LOC_Os03g44290 sequence information

Genomic sequence length: 2924 nucleotides

Beta-expansin 4 precursor putative expressed(EXPB12)
CDS length: 1107 nucleotides
Protein length: 368 amino acids

Forward primer: start 316 length 20 bp Tm 60.1

Reverse primer: start 556 length 20 bp Tm 59.8 Product size 241 bp

Score = 464 bits (241), Expect = 6e-127

Identities = 241/241 (100%), Gaps = 0/241 (0%) Strand=Plus/Minus

Seq TGCATTGACCATCGACTAGCTCTTCCAAGCATGGGCCACCAGGCCCCTGGTCAG

||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA TGCATTGACCATCGACTAGCTCTTCCAAGCATGGGCCACCAGGCCCCTGGTCAG

Seq TGATGACAACGGTTACAGGGATACCAGAGCAAGCTTCATTACCAGCACACACCAC

|||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA TGATGACAACGGTTACAGGGATACCAGAGCAAGCTTCATTACCAGCACACACCAC

Seq CCGGTAGCACGAACCACATCCCTTGCCAGAGTCATAGATGTAGGGGCTACCAGCA

|||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CCGGTAGCACGAACCACATCCCTTGCCAGAGTCATAGATGTAGGGGCTACCAGCA

Seq GCAATCCTGGATGAGAACGGTGGCTGGTCAACAGCATACTGGTACCCACATGCAC

|||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA GCAATCCTGGATGAGAACGGTGGCTGGTCAACAGCATACTGGTACCCACATGCAC

Seq CGCCTTCACTTCCTGCACCATT

||||||||||||||||||||||

cDNA CGCCTTCACTTCCTGCACCATT

UQ52_F GCACAAGCACAAGAAGGTGA

UQ52_R CCAAAGAACAGGAGCCTACG

Reverse primer: start 378 length 20 bp Tm 59.8

Forward primer: start 572 length 20 bp Tm 59.6 Product size 214 bp

Score = 412 bits (214), Expect = 2e-111

Identities = 214/214 (100%), Gaps = 0/214 (0%) Strand=Plus/Minus

Seq CCAAAGAACAGGAGCCTACGCCTAAGCCTGCTGGTTGTAGACGTAGGTGAGGCC

||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CCAAAGAACAGGAGCCTACGCCTAAGCCTGCTGGTTGTAGACGTAGGTGAGGCC

Seq GCACTTACCGCAGTAGTGGCGGTCGAAGTGGTTGGCCATGAAGGTGCCGGCGCC

||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA GCACTTACCGCAGTAGTGGCGGTCGAAGTGGTTGGCCATGAAGGTGCCGGCGCC

Seq GCACTCGGCGTTGGGGCACTCCTTGCGGAGGCGGGTGACCTTGCCGGTGGCGTC

||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA GCACTCGGCGTTGGGGCACTCCTTGCGGAGGCGGGTGACCTTGCCGGTGGCGTC

Seq GTCCACCTTGTAGAACTGGAGCACGGCGAGCTTCACCTTCTTGTGCTTGTGC

||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA GTCCACCTTGTAGAACTGGAGCACGGCGAGCTTCACCTTCTTGTGCTTGTGC

LOC_Os08g57840 sequence information

Phosphoenolpyruvate carboxylase, putative, expressed(PEPC)

Genomic sequence length: 5878 nucleotides

CDS length: 2895 nucleotides
Protein length: 964 amino acids
Left primer: start 1866 length 20 bp Tm 59.9

Right primer: start 2043 length 20 bp Tm 60.0 Product size 178 bp

Score = 326 bits (176), Expect = 2e-92

Identities = 178/179 (99%), Gaps = 0/179 (0%) Strand=Plus/Minus

Seg TGAAGCAAAGGTGCTCCTCACCAAAGGACTGCTCAATGACTTCACCCTGGACAGT

|||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA TGAAGCAAAGGTGCTCCTCACCAAAGGACTGCTCAATGACTTCACCCTGGACAGT

Seg GACCCGGAGAGATCCATGGATCGTGTCTGGTGGCTGAGACAAGATGGCAAGATGA

||||||||||||||||||||| |||||||||||||||||||||||||||||||||

cDNA GACCCGGAGAGATCCATGGATTGTGTCTGGTGGCTGAGACAAGATGGCAAGATGA

Seg GATGGGCCTCCGCCTCTTCCGACAGTCCCACCGCGCCCATGGAACATTGTCAACT

|||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA GATGGGCCTCCGCCTCTTCCGACAGTCCCACCGCGCCCATGGAACATTGTCAACT

Seg TCACCCCAAACTCC

||||||||||||||

cDNA TCACCCCAAACTCC

LOC_Os03g08490 sequence information

AP2 domain containing protein, expressed(ERF69)

Genomic sequence length: 1283 nucleotides

CDS length: 966 nucleotides
Protein length: 321 amino acids
Left primer: start 801 length 20 bp Tm 59.4

Right primer: start 959 length 20 bp Tm 59.1 Product size 159 bp

Score = 289 bits (156), Expect = 1e-81

Identities = 158/159 (99%), Gaps = 0/159 (0%) Strand=Plus/Minus

Seg TACGACGCGTTGAGAAAGTCGTCGCCGAAGCTCCAGAGCCCCACGCTCTCGCCG

||||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA TACGACGCGTTGAGAAAGTCGTCGCCGAAGCTCCAGAGCCCCACGCTCTCGCCG

Seg GCGACGTTCGCTTCACCGGCGGCGAACAGCCCGTCCATGAGCGAGGCGAACGCA

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA GCGACGTTCGCTTCACCGGCGGCGAACAGCCCGTCCATGAGCGAGGCGAACGCG

Seg CCGCCGTTGAGGTCGCCGAACTGGTCGCCGAACAAGAAAGGATCGTCGAGC

||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CCGCCGTTGAGGTCGCCGAACTGGTCGCCGAACAAGAAAGGATCGTCGAGC

LOC_Os05g09500 sequence information

Hexokinase, putative, expressed(HXK7)

Genomic sequence length: 4016 nucleotides

CDS length: 1392 nucleotides
Protein length: 463 amino acids

Left primer: start 954 length 20 bp Tm 60.0

Right primer: start 1085 length 21 bp Tm 60.0 Product size 152 bp

Score = 281 bits (152), Expect = 3e-79

Identities = 152/152 (100%), Gaps = 0/152 (0%) Strand=Plus/Minus

Seg TTTCGACAACCATCTTCCTTGTTTCTAAGGATGTGTCTGTGATCTTCAGGTT

||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA TTTCGACAACCATCTTCCTTGTTTCTAAGGATGTGTCTGTGATCTTCAGGTT

Seg ATCTGCAAGTTTTTCAGCCACAATTCTGAGATCAGGTGTTCCATCATGATGC

||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA ATCTGCAAGTTTTTCAGCCACAATTCTGAGATCAGGTGTTCCATCATGATGC

Seg ATCACGGAAATATCAGGAGTCCTCAGAATAAAGCGGGTTTTGAGCTTG

||||||||||||||||||||||||||||||||||||||||||||||||

cDNA ATCACGGAAATATCAGGAGTCCTCAGAATAAAGCGGGTTTTGAGCTTG

LOC_Os10g13700 sequence information

Phosphoenolpyruvate carboxykinase, putative, expressed (PCK)

Genomic sequence length: 5774 nucleotides

CDS length: 1605 nucleotides
Protein length: 534 amino acids
Left primer: start 276 length 20 bp Tm 60.0

Right primer: start 463 length 20 bp Tm 60.0 Product size 188 bp

Score = 348 bits (188), Expect = 3e-99

Identities = 188/188 (100%), Gaps = 0/188 (0%) Strand=Plus/Minus

Seg CGGTCTTTGCTCCTGATAGCGTCGCTAACGCCCCACTGGATGTGATGAATGAC

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CGGTCTTTGCTCCTGATAGCGTCGCTAACGCCCCACTGGATGTGATGAATGAC

Seg CCTTTCTCATATTTGATTGCATGCTCATAAAGTTCAGAAGGGGATAAGTTGTA

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CCTTTCTCATATTTGATTGCATGCTCATAAAGTTCAGAAGGGGATAAGTTGTA

Seg CAGAACATGGGTGAACTTGAGGTCACTGTCGCTCACAGTGATCGTGGGGACAG

|||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA CAGAACATGGGTGAACTTGAGGTCACTGTCGCTCACAGTGATCGTGGGGACAG

Seg TGATATGGTGTTGGTGATGTGTCACAGCC

|||||||||||||||||||||||||||||

cDNA TGATATGGTGTTGGTGATGTGTCACAGCC

LOC_Os11g47560 sequence information

Glycosyl hydrolase, putative, expressed (XIP)

Genomic sequence length: 1095 nucleotides

CDS length: 855 nucleotides
Protein length: 284 amino acids
Left primer: start 188 length 20 bp Tm 60.3

Right primer: start 389 length 20 bp Tm 60.1 Product size 202 bp

Score = 375 bits (203), Expect = 7e-108

Identities = 203/203 (100%), Gaps = 0/203 (0%) Strand=Plus/Minus

Seg AGGTAGGCGTTCCAGAGGTTATCGGCGACGTCGGAGGCCGACTGGGAGGACG

||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA AGGTAGGCGTTCCAGAGGTTATCGGCGACGTCGGAGGCCGACTGGGAGGACG

Seg GGAGCGAGTACTCGCCGCCCTGGCCGCCGATGGAGAGGAGGACCTGGACGCC

||||||||||||||||||||||||||||||||||||||||||||||||||||

cDNA GGAGCGAGTACTCGCCGCCCTGGCCGCCGATGGAGAGGAGGACCTGGACGCC

Seg CTTGGACTGGCAGTGCTTGATGTCGGCGCCGACGGCGGCGACCGGGTGGCCG

||||||||||||||||||||||||||||||||||||||||||||||||||||

cDN CTTGGACTGGCAGTGCTTGATGTCGGCGCCGACGGCGGCGACCGGGTGGCCG

Seg GAGAAGTCGAGGCCGTACCTGCCGCGCTGGTAGCCGAAGACGTTGT

||||||||||||||||||||||||||||||||||||||||||||||

cDNA GAGAAGTCGAGGCCGTACCTGCCGCGCTGGTAGCCGAAGACGTTGT

5.6. Transcripts profile in selected cultivars under the experimental conditions

5.6.1. Seed germination and sample extraction

The seeds of selected rice cultivars (IR-72 and PSBRC09) were grown as described earlier (Section 3.7). Plant material (coleoptiles) was obtained from 4 days old aerobically grown and 6 day old flooded seedlings. RNA extraction and cDNA preparation from coleoptiles was done as mentioned earlier (Section 3.7). Two biological replicates were tested in three replicates using PCR and were run on gel. The DNA intensity of the bands generated was quantified using METAMORPH software.

5.6.2. Results

Fig Transcript profile of selected genes 1. ADh3, 2. ADh3, 3.RAmy3D, 4. EXPA2, 5.EXPA4, 6.EXPB2, 7.EXPB6, 8.EXPB11, 9.EXPB12 and 10 UQ52 in replicates. Hyper ladder V in first and last well.

The gene transcripts results indicate significant difference under the experimental conditions following the predictions based on hypoxia or anoxic conditions from the literature. The alcohol dehydrogenase genes (ADh3 and ADh3) are highly induced under anoxia in cultivar IR-72 but not in PSBRC09. Amylase gene (RAmy3D) is repressed under flooded conditions in both the cultivars. Transcripts of PEPC and ERF69 were higher in aerobic conditions in both the cultivars. The transcripts for PCK appeared higher in flooded conditions for both the cultivars.

Among the expansin gene family, EXPA2, EXPA4 and EXPB2 were upregulated under flooded conditions in both the cultivars. EXPA7 was upregulated in IR-72 cultivar under flooded conditions while repressed in PSBRC09 under same conditions while EXPB6 showed enhanced expression in PSBRC09 under flooded conditions but down regulated in IR-72 under similar conditions. EXPB11 and EXPB12 were highly induced under flooded conditions in IR-72 while repressed in PSBRC09.

The gene transcripts of the reference genes UQ52 did not vary significantly. XIP's were highly induced under flooded conditions in both the cultivars.

To conclude, the potential of these selected transcripts indicating the cultivar responses to environment has been demonstrated. Replication of this approach involving further cultivars and growth stages will be necessary to confirm their utility as marker tools for selection.

Please be aware that the free essay that you were just reading was not written by us. This essay, and all of the others available to view on the website, were provided to us by students in exchange for services that we offer. This relationship helps our students to get an even better deal while also contributing to the biggest free essay resource in the UK!